Index of /public/dataset/Onso/IDT_xGen

 Name                    Last modified      Size  Description
 Parent Directory                             -   
 Onso_IDT_xGen_cfDNA/    2024-06-01 12:55    -   
 Onso_IDT_xGen_gDNA/     2024-06-01 11:35    -   
 README.txt              2024-06-01 14:04  4.0K  

# PacBio Onso Sequencing of Low Input Samples Using IDT xGen High-Conversion NGS Library Prep Technology

## Legal disclaimer

All trademarks, trade names, or logos mentioned or used are the property of their respective owners.

## Sample Description

To test the sensitivity of the workflow based on mass input, a Myeloid DNA Reference Standard (HD829) from Horizon was used to generate libraries using the xGen cfDNA & FFPE Library Prep Kit with xGen UDI Primer Pairs. The reference standard was sheared targeting a 150 bp insert size using a Covaris(R) to mimic the size of typical cfDNA samples. Libraries were generated in triplicate using low inputs of 1 ng and 10 ng into library preparation.

Similarly, to determine the sensitivity of this workflow based on low allele frequencies, a Myeloid cfDNA Reference Standard (HD838) from Horizon was used to generate libraries with the xGen cfDNA & FFPE Library Prep Kit with xGen UDI Primer Pairs. Libraries were generated in triplicate using 25 ng and 50 ng inputs.

An xGen Custom Hyb Panel was designed to target all variants in the reference standards (HD838 and HD829) as well as other known oncological variants. The hot-spot panel targets space covers 8,890 bases using 111 probes. Triplicate libraries were multiplexed, and hybrid captures (n = 4) using xGen Hybridization Capture Core Reagents were performed using 16-hour hybridizations following the xGen Hybridization Capture Protocol. Captured libraries were then converted using the Onso library conversion kit, which uses 5 cycles of PCR to add the Onso adapter sequences using primers complementary to the existing P5/P7 adapter sequences. 

## Data

The "Onso_IDT_xGen_gDNA" and "Onso_IDT_xGen_cfDNA" folders contain the raw (untrimmed) target enriched library reads sequenced on a PacBio Onso instrument. The read data contain XXXXX UMIs (8 BP) and Illumina P5/P7 adapters that should be trimmed prior to analysis (described later). The libraries were sequenced with paired-end 2x150bp sequencing chemistry and demultiplexed using an in-house tool.

### Samples

Below is a brief description of each sample:

- gDNA_1ng_250K
    - Three (3) replicates of gDNA using 1 ng for library prep, down sampled to 250,000 reads/sample
- gDNA_10ng_250K
    - Three (3) replicates of gDNA using 10 ng for library prep, down sampled to 250,000 reads/sample
- cfDNA_25ng_50M
    - Three (3) replicates of cfDNA using 25 ng for library prep, down sampled to 50 million reads/sample
- cfDNA_50ng_50M
    - Three (3) replicates of cfDNA using 50 ng for library prep, down sampled to 50 million reads/sample


### Data Processing

The data shared here are untrimmed, but we would recommend trimming out the 8 BP UMIs at the beginning of both R1 and R2 insert reads, as well as the adapter sequences. We use `cutadapt` to trim Illumina P5/P7 adapters from the 5' end of reads -- more details on this are provided below.

### Read filtering

Prior to releasing the data, reads were filtered to exclude read pairs with reads < 32 BP in length. That was performed using the following:

```bash
cutadapt \
    --minimum-length 32 \
    -j 10 \
    -o {input.fastq1} \
    -p {output.fastq1} \
    {input.fastq2} \
    {output.fastq2}
```

### Adapter Trimming

Adapter trimming was completed with the following (generic) command:

```bash
cutadapt \
    -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
    --overlap 3 \
    -j 10 \
    -o {output.fastq1} \
    -p {output.fastq2} \
    {input.fastq1} \
    {input.fastq2}
```

### Down sampling reads

Reads were down sampled using `seqtk`. An example command is shown below:

```bash
seqtk sample \
    -s0 \
    {input.fastq} \
    {params.subsample_read_pairs} | \
    gzip - > {output.fastq}
```

### Mapping, deduplication, and variant calling

Subsequent analyses were performed as recommended in the xGen cfDNA and FFPE DNA Library Prep Kit Analysis Guidelines: https://sfvideo.blob.core.windows.net/sitefinity/docs/default-source/user-guide-manual/xgen-cfdna-and-ffpe-dna-library-prep-kit-analysis-guidelines.pdf?sfvrsn=96c8fe07_10


*Rev 2024-06-01*