{
  "metadata": {
    "namedAlleleMatcherVersion": "2.0.0",
    "genomeBuild": "GRCh38.p13",
    "inputFilename": "HG002.GRCh38.small_variants.phased.preprocessed.filtered.vcf",
    "timestamp": "2026-06-12T19:15:01.372Z",
    "topCandidatesOnly": true,
    "findCombinations": false,
    "callCyp2d": false
  },
  "results": [
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr4",
      "gene": "ABCG2",
      "diplotypes": [
        {
          "name": "rs2231142 reference (G)/rs2231142 reference (G)",
          "haplotype1": {
            "name": "rs2231142 reference (G)",
            "haplotype": {
              "name": "rs2231142 reference (G)",
              "id": "PA166287823",
              "alleles": [
                "G"
              ],
              "cpicAlleles": [
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "88131171:G;"
            ]
          },
          "haplotype2": {
            "name": "rs2231142 reference (G)",
            "haplotype": {
              "name": "rs2231142 reference (G)",
              "id": "PA166287823",
              "alleles": [
                "G"
              ],
              "cpicAlleles": [
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "88131171:G;"
            ]
          },
          "score": 2
        }
      ],
      "haplotypes": [
        {
          "name": "rs2231142 reference (G)",
          "haplotype": {
            "name": "rs2231142 reference (G)",
            "id": "PA166287823",
            "alleles": [
              "G"
            ],
            "cpicAlleles": [
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "88131171:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 88131171,
          "rsid": "rs2231142",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr1",
      "gene": "CACNA1S",
      "diplotypes": [
        {
          "name": "Reference/Reference",
          "haplotype1": {
            "name": "Reference",
            "haplotype": {
              "name": "Reference",
              "id": "PA166180429",
              "alleles": [
                "C",
                "G"
              ],
              "cpicAlleles": [
                "C",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "201060815:C;201091993:G;"
            ]
          },
          "haplotype2": {
            "name": "Reference",
            "haplotype": {
              "name": "Reference",
              "id": "PA166180429",
              "alleles": [
                "C",
                "G"
              ],
              "cpicAlleles": [
                "C",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "201060815:C;201091993:G;"
            ]
          },
          "score": 4
        }
      ],
      "haplotypes": [
        {
          "name": "Reference",
          "haplotype": {
            "name": "Reference",
            "id": "PA166180429",
            "alleles": [
              "C",
              "G"
            ],
            "cpicAlleles": [
              "C",
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "201060815:C;201091993:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 201060815,
          "rsid": "rs1800559",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 201091993,
          "rsid": "rs772226819",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr7",
      "gene": "CFTR",
      "diplotypes": [
        {
          "name": "ivacaftor non-responsive CFTR sequence/ivacaftor non-responsive CFTR sequence",
          "haplotype1": {
            "name": "ivacaftor non-responsive CFTR sequence",
            "haplotype": {
              "name": "ivacaftor non-responsive CFTR sequence",
              "id": "PA166218381",
              "alleles": [
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "A",
                "T",
                "G",
                "G",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "A",
                "T",
                "A",
                "G",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "T",
                "G",
                "G"
              ],
              "cpicAlleles": [
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "A",
                "T",
                "G",
                "G",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "A",
                "T",
                "A",
                "G",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "T",
                "G",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "117509035:G;117509069:C;117509089:C;117530953:G;117530955:C;117530974:C;117530975:G;117534318:G;117534363:G;117534368:A;117535285:T;117540270:G;117540285:G;117548795:C;117587799:A;117587800:G;117587801:T;117587805:G;117587806:G;117590409:A;117594930:G;117602868:G;117603708:C;117606695:C;117611555:A;117611595:T;117611620:A;117611640:G;117611646:G;117611649:C;117611650:G;117611663:T;117614699:G;117639961:C;117642451:G;117642472:G;117642483:T;117642528:G;117664770:G;"
            ]
          },
          "haplotype2": {
            "name": "ivacaftor non-responsive CFTR sequence",
            "haplotype": {
              "name": "ivacaftor non-responsive CFTR sequence",
              "id": "PA166218381",
              "alleles": [
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "A",
                "T",
                "G",
                "G",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "A",
                "T",
                "A",
                "G",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "T",
                "G",
                "G"
              ],
              "cpicAlleles": [
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "A",
                "T",
                "G",
                "G",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "A",
                "T",
                "A",
                "G",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "T",
                "G",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "117509035:G;117509069:C;117509089:C;117530953:G;117530955:C;117530974:C;117530975:G;117534318:G;117534363:G;117534368:A;117535285:T;117540270:G;117540285:G;117548795:C;117587799:A;117587800:G;117587801:T;117587805:G;117587806:G;117590409:A;117594930:G;117602868:G;117603708:C;117606695:C;117611555:A;117611595:T;117611620:A;117611640:G;117611646:G;117611649:C;117611650:G;117611663:T;117614699:G;117639961:C;117642451:G;117642472:G;117642483:T;117642528:G;117664770:G;"
            ]
          },
          "score": 78
        }
      ],
      "haplotypes": [
        {
          "name": "ivacaftor non-responsive CFTR sequence",
          "haplotype": {
            "name": "ivacaftor non-responsive CFTR sequence",
            "id": "PA166218381",
            "alleles": [
              "G",
              "C",
              "C",
              "G",
              "C",
              "C",
              "G",
              "G",
              "G",
              "A",
              "T",
              "G",
              "G",
              "C",
              "A",
              "G",
              "T",
              "G",
              "G",
              "A",
              "G",
              "G",
              "C",
              "C",
              "A",
              "T",
              "A",
              "G",
              "G",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "G",
              "T",
              "G",
              "G"
            ],
            "cpicAlleles": [
              "G",
              "C",
              "C",
              "G",
              "C",
              "C",
              "G",
              "G",
              "G",
              "A",
              "T",
              "G",
              "G",
              "C",
              "A",
              "G",
              "T",
              "G",
              "G",
              "A",
              "G",
              "G",
              "C",
              "C",
              "A",
              "T",
              "A",
              "G",
              "G",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "G",
              "T",
              "G",
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "117509035:G;117509069:C;117509089:C;117530953:G;117530955:C;117530974:C;117530975:G;117534318:G;117534363:G;117534368:A;117535285:T;117540270:G;117540285:G;117548795:C;117587799:A;117587800:G;117587801:T;117587805:G;117587806:G;117590409:A;117594930:G;117602868:G;117603708:C;117606695:C;117611555:A;117611595:T;117611620:A;117611640:G;117611646:G;117611649:C;117611650:G;117611663:T;117614699:G;117639961:C;117642451:G;117642472:G;117642483:T;117642528:G;117664770:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 117509035,
          "rsid": "rs397508256",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117509069,
          "rsid": "rs368505753",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117509089,
          "rsid": "rs115545701",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117530953,
          "rsid": "rs113993958",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117530955,
          "rsid": "rs397508537",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117530974,
          "rsid": "rs77834169",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117530975,
          "rsid": "rs78655421",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117534318,
          "rsid": "rs80282562",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117534363,
          "rsid": "rs397508759",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117534368,
          "rsid": "rs397508761",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 117535285,
          "rsid": "rs121908752",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 117540270,
          "rsid": "rs77932196",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117540285,
          "rsid": "rs121908753",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117548795,
          "rsid": "rs74551128",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117587799,
          "rsid": "rs121908757",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 117587800,
          "rsid": "rs121908755",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117587801,
          "rsid": "rs121909005",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 117587805,
          "rsid": "rs121909013",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117587806,
          "rsid": "rs75527207",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117590409,
          "rsid": "rs397508288",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 117594930,
          "rsid": "rs397508387",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117602868,
          "rsid": "rs80224560",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117603708,
          "rsid": "rs397508442",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117606695,
          "rsid": "rs141033578",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117611555,
          "rsid": "rs76151804",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 117611595,
          "rsid": "rs150212784",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 117611620,
          "rsid": "rs397508513",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 117611640,
          "rsid": "rs121909020",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117611646,
          "rsid": "rs200321110",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117611649,
          "rsid": "rs202179988",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117611650,
          "rsid": "rs78769542",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117611663,
          "rsid": "rs186045772",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 117614699,
          "rsid": "rs75541969",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117639961,
          "rsid": "rs75039782",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 117642451,
          "rsid": "rs267606723",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117642472,
          "rsid": "rs74503330",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117642483,
          "rsid": "rs121909041",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 117642528,
          "rsid": "rs11971167",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 117664770,
          "rsid": "rs193922525",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr19",
      "gene": "CYP2B6",
      "diplotypes": [
        {
          "name": "*2/*5",
          "haplotype1": {
            "name": "*2",
            "haplotype": {
              "name": "*2",
              "id": "PA165818753",
              "alleles": [
                "T",
                "A",
                "T",
                "A",
                "A",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "G",
                "T",
                "A",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "T",
                "T",
                "A",
                "C",
                "A",
                "G",
                "C",
                "C",
                "T",
                "C",
                "T",
                "A",
                "C",
                "G",
                "T",
                "T",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "G",
                "A",
                "C"
              ],
              "cpicAlleles": [
                "T",
                "A",
                "T",
                "A",
                "A",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "G",
                "T",
                "A",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "T",
                "T",
                "A",
                "C",
                "A",
                "G",
                "C",
                "C",
                "T",
                "C",
                "T",
                "A",
                "C",
                "G",
                "T",
                "T",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "G",
                "A",
                "C"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "40991224:T;40991367:A;40991369:T;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004133:G;41004158:G;41004303:T;41004377:A;41004380:C;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006967:G;41006968:T;41007013:T;41009313:A;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012393:T;41012394:A;41012465:C;41012466:G;41012471:T;41012478:T;41012693:T;41012740:G;41012803:C;41016652:G;41016679:G;41016726:A;41016741:G;41016778:G;41016805:A;41016810:C;"
            ]
          },
          "haplotype2": {
            "name": "*5",
            "haplotype": {
              "name": "*5",
              "id": "PA165818760",
              "alleles": [
                "T",
                "A",
                "C",
                "A",
                "A",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "G",
                "T",
                "A",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "T",
                "T",
                "A",
                "C",
                "A",
                "G",
                "C",
                "C",
                "T",
                "C",
                "T",
                "A",
                "C",
                "G",
                "T",
                "T",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "G",
                "A",
                "T"
              ],
              "cpicAlleles": [
                "T",
                "A",
                "C",
                "A",
                "A",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "G",
                "T",
                "A",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "T",
                "T",
                "A",
                "C",
                "A",
                "G",
                "C",
                "C",
                "T",
                "C",
                "T",
                "A",
                "C",
                "G",
                "T",
                "T",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "G",
                "A",
                "T"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "40991224:T;40991367:A;40991369:C;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004133:G;41004158:G;41004303:T;41004377:A;41004380:C;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006967:G;41006968:T;41007013:T;41009313:A;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012393:T;41012394:A;41012465:C;41012466:G;41012471:T;41012478:T;41012693:T;41012740:G;41012803:C;41016652:G;41016679:G;41016726:A;41016741:G;41016778:G;41016805:A;41016810:T;"
            ]
          },
          "score": 2
        }
      ],
      "haplotypes": [
        {
          "name": "*2",
          "haplotype": {
            "name": "*2",
            "id": "PA165818753",
            "alleles": [
              "T",
              "A",
              "T",
              "A",
              "A",
              "C",
              "G",
              "A",
              "T",
              "G",
              "G",
              "G",
              "T",
              "A",
              "C",
              "G",
              "G",
              "C",
              "C",
              "G",
              "G",
              "T",
              "T",
              "A",
              "C",
              "A",
              "G",
              "C",
              "C",
              "T",
              "C",
              "T",
              "A",
              "C",
              "G",
              "T",
              "T",
              "T",
              "G",
              "C",
              "G",
              "G",
              "A",
              "G",
              "G",
              "A",
              "C"
            ],
            "cpicAlleles": [
              "T",
              "A",
              "T",
              "A",
              "A",
              "C",
              "G",
              "A",
              "T",
              "G",
              "G",
              "G",
              "T",
              "A",
              "C",
              "G",
              "G",
              "C",
              "C",
              "G",
              "G",
              "T",
              "T",
              "A",
              "C",
              "A",
              "G",
              "C",
              "C",
              "T",
              "C",
              "T",
              "A",
              "C",
              "G",
              "T",
              "T",
              "T",
              "G",
              "C",
              "G",
              "G",
              "A",
              "G",
              "G",
              "A",
              "C"
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "40991224:T;40991367:A;40991369:T;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004133:G;41004158:G;41004303:T;41004377:A;41004380:C;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006967:G;41006968:T;41007013:T;41009313:A;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012393:T;41012394:A;41012465:C;41012466:G;41012471:T;41012478:T;41012693:T;41012740:G;41012803:C;41016652:G;41016679:G;41016726:A;41016741:G;41016778:G;41016805:A;41016810:C;"
          ]
        },
        {
          "name": "*5",
          "haplotype": {
            "name": "*5",
            "id": "PA165818760",
            "alleles": [
              "T",
              "A",
              "C",
              "A",
              "A",
              "C",
              "G",
              "A",
              "T",
              "G",
              "G",
              "G",
              "T",
              "A",
              "C",
              "G",
              "G",
              "C",
              "C",
              "G",
              "G",
              "T",
              "T",
              "A",
              "C",
              "A",
              "G",
              "C",
              "C",
              "T",
              "C",
              "T",
              "A",
              "C",
              "G",
              "T",
              "T",
              "T",
              "G",
              "C",
              "G",
              "G",
              "A",
              "G",
              "G",
              "A",
              "T"
            ],
            "cpicAlleles": [
              "T",
              "A",
              "C",
              "A",
              "A",
              "C",
              "G",
              "A",
              "T",
              "G",
              "G",
              "G",
              "T",
              "A",
              "C",
              "G",
              "G",
              "C",
              "C",
              "G",
              "G",
              "T",
              "T",
              "A",
              "C",
              "A",
              "G",
              "C",
              "C",
              "T",
              "C",
              "T",
              "A",
              "C",
              "G",
              "T",
              "T",
              "T",
              "G",
              "C",
              "G",
              "G",
              "A",
              "G",
              "G",
              "A",
              "T"
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "40991224:T;40991367:A;40991369:C;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004133:G;41004158:G;41004303:T;41004377:A;41004380:C;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006967:G;41006968:T;41007013:T;41009313:A;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012393:T;41012394:A;41012465:C;41012466:G;41012471:T;41012478:T;41012693:T;41012740:G;41012803:C;41016652:G;41016679:G;41016726:A;41016741:G;41016778:G;41016805:A;41016810:T;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 40991224,
          "rsid": "rs34223104",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 40991367,
          "rsid": "rs34883432",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 40991369,
          "rsid": "rs8192709",
          "vcfCall": "T|C",
          "phased": true
        },
        {
          "position": 40991381,
          "rsid": "rs33973337",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 40991388,
          "rsid": "rs33980385",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 40991390,
          "rsid": "rs33926104",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 40991391,
          "rsid": "rs34284776",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 40991441,
          "rsid": "rs35303484",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41004015,
          "rsid": "rs281864907",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41004125,
          "rsid": "rs36060847",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41004133,
          "rsid": "rs148009906",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41004158,
          "rsid": "rs186335453",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41004303,
          "rsid": "rs139801276",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41004377,
          "rsid": "rs12721655",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41004380,
          "rsid": "rs535039125",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41004381,
          "rsid": "rs35773040",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41004406,
          "rsid": "rs145884402",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41006919,
          "rsid": "rs3826711",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41006923,
          "rsid": "rs36056539",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41006936,
          "rsid": "rs3745274",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41006967,
          "rsid": "rs58871670",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41006968,
          "rsid": "rs373489637",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41007013,
          "rsid": "rs36079186",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41009313,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41009350,
          "rsid": "rs45482602",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41009358,
          "rsid": "rs2279343",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41010006,
          "rsid": "rs139029625",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41010088,
          "rsid": "rs34698757",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41010108,
          "rsid": "rs193922917",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41012316,
          "rsid": "rs28399499",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41012339,
          "rsid": "rs34826503",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41012393,
          "rsid": "rs754621576",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41012394,
          "rsid": "rs780991919",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41012465,
          "rsid": "rs34097093",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41012466,
          "rsid": "rs200458614",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41012471,
          "rsid": "rs201500445",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41012478,
          "rsid": "rs200238771",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41012693,
          "rsid": "rs35979566",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 41012740,
          "rsid": "rs193922918",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41012803,
          "rsid": "rs35010098",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 41016652,
          "rsid": "rs764288403",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41016679,
          "rsid": "rs374099483",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41016726,
          "rsid": "rs3211369",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41016741,
          "rsid": "rs117872433",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41016778,
          "rsid": "rs564083989",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 41016805,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 41016810,
          "rsid": "rs3211371",
          "vcfCall": "C|T",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": false,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr10",
      "gene": "CYP2C19",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165980634",
              "alleles": [
                "C",
                "A",
                "C",
                "T",
                "T",
                "A",
                "A",
                "A",
                "C",
                "C",
                "G",
                "A",
                "A",
                "T",
                "A",
                "G",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "T",
                "G",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "C",
                "A"
              ],
              "cpicAlleles": [
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                "G",
                null,
                null,
                null,
                null,
                null,
                null,
                null
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "94761900:C;94762706:A;94762712:C;94762715:T;94762755:T;94762760:A;94762788:A;94762856:A;94775106:C;94775121:C;94775160:G;94775185:A;94775367:A;94775416:T;94775423:A;94775453:G;94775489:G;94775507:G;94780574:G;94780579:G;94780653:G;94781858:C;94781859:G;94781944:G;94781999:T;94842861:G;94842866:G;94842879:G;94842995:G;94849995:C;94852738:C;94852765:C;94852785:C;94852914:A;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165980634",
              "alleles": [
                "C",
                "A",
                "C",
                "T",
                "T",
                "A",
                "A",
                "A",
                "C",
                "C",
                "G",
                "A",
                "A",
                "T",
                "A",
                "G",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "T",
                "G",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "C",
                "A"
              ],
              "cpicAlleles": [
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                null,
                "G",
                null,
                null,
                null,
                null,
                null,
                null,
                null
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "94761900:C;94762706:A;94762712:C;94762715:T;94762755:T;94762760:A;94762788:A;94762856:A;94775106:C;94775121:C;94775160:G;94775185:A;94775367:A;94775416:T;94775423:A;94775453:G;94775489:G;94775507:G;94780574:G;94780579:G;94780653:G;94781858:C;94781859:G;94781944:G;94781999:T;94842861:G;94842866:G;94842879:G;94842995:G;94849995:C;94852738:C;94852765:C;94852785:C;94852914:A;"
            ]
          },
          "score": 68
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA165980634",
            "alleles": [
              "C",
              "A",
              "C",
              "T",
              "T",
              "A",
              "A",
              "A",
              "C",
              "C",
              "G",
              "A",
              "A",
              "T",
              "A",
              "G",
              "G",
              "G",
              "G",
              "G",
              "G",
              "C",
              "G",
              "G",
              "T",
              "G",
              "G",
              "G",
              "G",
              "C",
              "C",
              "C",
              "C",
              "A"
            ],
            "cpicAlleles": [
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              null,
              "G",
              null,
              null,
              null,
              null,
              null,
              null,
              null
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "94761900:C;94762706:A;94762712:C;94762715:T;94762755:T;94762760:A;94762788:A;94762856:A;94775106:C;94775121:C;94775160:G;94775185:A;94775367:A;94775416:T;94775423:A;94775453:G;94775489:G;94775507:G;94780574:G;94780579:G;94780653:G;94781858:C;94781859:G;94781944:G;94781999:T;94842861:G;94842866:G;94842879:G;94842995:G;94849995:C;94852738:C;94852765:C;94852785:C;94852914:A;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": false,
      "variants": [
        {
          "position": 94761900,
          "rsid": "rs12248560",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94762706,
          "rsid": "rs28399504",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94762712,
          "rsid": "rs367543002",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94762715,
          "rsid": "rs367543003",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94762755,
          "rsid": "rs55752064",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94762760,
          "rsid": "rs17882687",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94762788,
          "rsid": "rs1564656981",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94762856,
          "rsid": "rs1564657013",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94775106,
          "rsid": "rs145328984",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94775121,
          "rsid": "rs1564660997",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94775160,
          "rsid": "rs118203756",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94775185,
          "rsid": "rs1288601658",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94775367,
          "rsid": "rs12769205",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94775416,
          "rsid": "rs41291556",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94775423,
          "rsid": "rs17885179",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94775453,
          "rsid": "rs72552267",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94775489,
          "rsid": "rs17884712",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94775507,
          "rsid": "rs58973490",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94780574,
          "rsid": "rs140278421",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94780579,
          "rsid": "rs370803989",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94780653,
          "rsid": "rs4986893",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94781858,
          "rsid": "rs6413438",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94781859,
          "rsid": "rs4244285",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94781944,
          "rsid": "rs375781227",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94781999,
          "rsid": "rs72558186",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94842861,
          "rsid": "rs138142612",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94842866,
          "rsid": "rs3758581",
          "vcfCall": "G/G",
          "phased": false
        },
        {
          "position": 94842879,
          "rsid": "rs118203757",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94842995,
          "rsid": "rs113934938",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94849995,
          "rsid": "rs17879685",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94852738,
          "rsid": "rs56337013",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94852765,
          "rsid": "rs192154563",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94852785,
          "rsid": "rs118203759",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94852914,
          "rsid": "rs55640102",
          "vcfCall": "A|A",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": false,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr10",
      "gene": "CYP2C9",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165816542",
              "alleles": [
                "A",
                "T",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "G",
                "G",
                "T",
                "G",
                "G",
                "G",
                "T",
                "CAATGGAAAGA",
                "A",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "A",
                "A",
                "T",
                "A",
                "G",
                "A",
                "C",
                "C",
                "AT",
                "A",
                "A",
                "GA",
                "C",
                "C",
                "A",
                "A",
                "C",
                "A",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G"
              ],
              "cpicAlleles": [
                "A",
                "T",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "G",
                "G",
                "T",
                "G",
                "G",
                "G",
                "T",
                "AGAAATGGAA",
                "A",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "A",
                "A",
                "T",
                "A",
                "G",
                "A",
                "C",
                "C",
                "T",
                "A",
                "A",
                "A",
                "C",
                "C",
                "A",
                "A",
                "C",
                "A",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "94938683:A;94938719:T;94938737:C;94938771:C;94938788:C;94938800:G;94938803:A;94938828:A;94941897:G;94941915:G;94941958:T;94941975:G;94941976:G;94941982:G;94942018:T;94942205:CAATGGAAAGA;94942216:A;94942230:C;94942231:G;94942233:C;94942234:G;94942243:T;94942249:C;94942254:C;94942255:G;94942290:C;94942291:G;94942305:G;94942306:C;94942308:C;94942309:G;94947782:C;94947785:C;94947869:A;94947907:A;94947917:T;94947938:A;94947939:G;94949129:A;94949144:C;94949145:C;94949161:AT;94949217:A;94949280:A;94949281:GA;94972119:C;94972123:C;94972134:A;94972179:A;94972180:C;94972183:A;94972233:C;94981199:G;94981201:T;94981224:C;94981225:G;94981230:C;94981250:C;94981258:C;94981281:G;94981296:A;94981297:T;94981301:C;94981302:C;94981305:C;94981365:C;94981371:G;94986042:A;94986073:A;94986136:A;94986174:G;94988852:C;94988855:A;94988880:G;94988917:G;94988925:A;94988955:T;94988984:G;94989020:C;94989023:G;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165816542",
              "alleles": [
                "A",
                "T",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "G",
                "G",
                "T",
                "G",
                "G",
                "G",
                "T",
                "CAATGGAAAGA",
                "A",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "A",
                "A",
                "T",
                "A",
                "G",
                "A",
                "C",
                "C",
                "AT",
                "A",
                "A",
                "GA",
                "C",
                "C",
                "A",
                "A",
                "C",
                "A",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G"
              ],
              "cpicAlleles": [
                "A",
                "T",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "G",
                "G",
                "T",
                "G",
                "G",
                "G",
                "T",
                "AGAAATGGAA",
                "A",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "A",
                "A",
                "T",
                "A",
                "G",
                "A",
                "C",
                "C",
                "T",
                "A",
                "A",
                "A",
                "C",
                "C",
                "A",
                "A",
                "C",
                "A",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "94938683:A;94938719:T;94938737:C;94938771:C;94938788:C;94938800:G;94938803:A;94938828:A;94941897:G;94941915:G;94941958:T;94941975:G;94941976:G;94941982:G;94942018:T;94942205:CAATGGAAAGA;94942216:A;94942230:C;94942231:G;94942233:C;94942234:G;94942243:T;94942249:C;94942254:C;94942255:G;94942290:C;94942291:G;94942305:G;94942306:C;94942308:C;94942309:G;94947782:C;94947785:C;94947869:A;94947907:A;94947917:T;94947938:A;94947939:G;94949129:A;94949144:C;94949145:C;94949161:AT;94949217:A;94949280:A;94949281:GA;94972119:C;94972123:C;94972134:A;94972179:A;94972180:C;94972183:A;94972233:C;94981199:G;94981201:T;94981224:C;94981225:G;94981230:C;94981250:C;94981258:C;94981281:G;94981296:A;94981297:T;94981301:C;94981302:C;94981305:C;94981365:C;94981371:G;94986042:A;94986073:A;94986136:A;94986174:G;94988852:C;94988855:A;94988880:G;94988917:G;94988925:A;94988955:T;94988984:G;94989020:C;94989023:G;"
            ]
          },
          "score": 160
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA165816542",
            "alleles": [
              "A",
              "T",
              "C",
              "C",
              "C",
              "G",
              "A",
              "A",
              "G",
              "G",
              "T",
              "G",
              "G",
              "G",
              "T",
              "CAATGGAAAGA",
              "A",
              "C",
              "G",
              "C",
              "G",
              "T",
              "C",
              "C",
              "G",
              "C",
              "G",
              "G",
              "C",
              "C",
              "G",
              "C",
              "C",
              "A",
              "A",
              "T",
              "A",
              "G",
              "A",
              "C",
              "C",
              "AT",
              "A",
              "A",
              "GA",
              "C",
              "C",
              "A",
              "A",
              "C",
              "A",
              "C",
              "G",
              "T",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "A",
              "T",
              "C",
              "C",
              "C",
              "C",
              "G",
              "A",
              "A",
              "A",
              "G",
              "C",
              "A",
              "G",
              "G",
              "A",
              "T",
              "G",
              "C",
              "G"
            ],
            "cpicAlleles": [
              "A",
              "T",
              "C",
              "C",
              "C",
              "G",
              "A",
              "A",
              "G",
              "G",
              "T",
              "G",
              "G",
              "G",
              "T",
              "AGAAATGGAA",
              "A",
              "C",
              "G",
              "C",
              "G",
              "T",
              "C",
              "C",
              "G",
              "C",
              "G",
              "G",
              "C",
              "C",
              "G",
              "C",
              "C",
              "A",
              "A",
              "T",
              "A",
              "G",
              "A",
              "C",
              "C",
              "T",
              "A",
              "A",
              "A",
              "C",
              "C",
              "A",
              "A",
              "C",
              "A",
              "C",
              "G",
              "T",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "A",
              "T",
              "C",
              "C",
              "C",
              "C",
              "G",
              "A",
              "A",
              "A",
              "G",
              "C",
              "A",
              "G",
              "G",
              "A",
              "T",
              "G",
              "C",
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "94938683:A;94938719:T;94938737:C;94938771:C;94938788:C;94938800:G;94938803:A;94938828:A;94941897:G;94941915:G;94941958:T;94941975:G;94941976:G;94941982:G;94942018:T;94942205:CAATGGAAAGA;94942216:A;94942230:C;94942231:G;94942233:C;94942234:G;94942243:T;94942249:C;94942254:C;94942255:G;94942290:C;94942291:G;94942305:G;94942306:C;94942308:C;94942309:G;94947782:C;94947785:C;94947869:A;94947907:A;94947917:T;94947938:A;94947939:G;94949129:A;94949144:C;94949145:C;94949161:AT;94949217:A;94949280:A;94949281:GA;94972119:C;94972123:C;94972134:A;94972179:A;94972180:C;94972183:A;94972233:C;94981199:G;94981201:T;94981224:C;94981225:G;94981230:C;94981250:C;94981258:C;94981281:G;94981296:A;94981297:T;94981301:C;94981302:C;94981305:C;94981365:C;94981371:G;94986042:A;94986073:A;94986136:A;94986174:G;94988852:C;94988855:A;94988880:G;94988917:G;94988925:A;94988955:T;94988984:G;94989020:C;94989023:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 94938683,
          "rsid": "rs114071557",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94938719,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94938737,
          "rsid": "rs67807361",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94938771,
          "rsid": "rs142240658",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94938788,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94938800,
          "rsid": "rs1364419386",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94938803,
          "rsid": "rs2031308986",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94938828,
          "rsid": "rs564813580",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94941897,
          "rsid": "rs371055887",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94941915,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94941958,
          "rsid": "rs72558187",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94941975,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94941976,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94941982,
          "rsid": "rs762239445",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94942018,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94942205,
          "rsid": "rs1304490498",
          "vcfCall": "CAATGGAAAGA|CAATGGAAAGA",
          "phased": true
        },
        {
          "position": 94942216,
          "rsid": "rs774607211",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94942230,
          "rsid": "rs767576260",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942231,
          "rsid": "rs12414460",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94942233,
          "rsid": "rs375805362",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942234,
          "rsid": "rs72558189",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94942243,
          "rsid": "rs1375956433",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94942249,
          "rsid": "rs200965026",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942254,
          "rsid": "rs199523631",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942255,
          "rsid": "rs200183364",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94942290,
          "rsid": "rs1799853",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942291,
          "rsid": "rs141489852",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94942305,
          "rsid": "rs754487195",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94942306,
          "rsid": "rs1289704600",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942308,
          "rsid": "rs17847037",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94942309,
          "rsid": "rs7900194",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94947782,
          "rsid": "rs72558190",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94947785,
          "rsid": "rs774550549",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94947869,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94947907,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94947917,
          "rsid": "rs1326630788",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94947938,
          "rsid": "rs2031531005",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94947939,
          "rsid": "rs370100007",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94949129,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94949144,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94949145,
          "rsid": "rs772782449",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94949161,
          "rsid": null,
          "vcfCall": "AT|AT",
          "phased": true
        },
        {
          "position": 94949217,
          "rsid": "rs2256871",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94949280,
          "rsid": "rs9332130",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94949281,
          "rsid": "rs9332131",
          "vcfCall": "GA|GA",
          "phased": true
        },
        {
          "position": 94972119,
          "rsid": "rs182132442",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94972123,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94972134,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94972179,
          "rsid": "rs72558192",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94972180,
          "rsid": "rs988617574",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94972183,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94972233,
          "rsid": "rs1237225311",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981199,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94981201,
          "rsid": "rs57505750",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94981224,
          "rsid": "rs28371685",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981225,
          "rsid": "rs367826293",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94981230,
          "rsid": "rs1274535931",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981250,
          "rsid": "rs750820937",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981258,
          "rsid": "rs1297714792",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981281,
          "rsid": "rs749060448",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94981296,
          "rsid": "rs1057910",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94981297,
          "rsid": "rs56165452",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94981301,
          "rsid": "rs28371686",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981302,
          "rsid": "rs1250577724",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981305,
          "rsid": "rs578144976",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981365,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94981371,
          "rsid": "rs542577750",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94986042,
          "rsid": "rs764211126",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94986073,
          "rsid": "rs72558193",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94986136,
          "rsid": "rs1254213342",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94986174,
          "rsid": "rs1441296358",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94988852,
          "rsid": "rs776908257",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94988855,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94988880,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94988917,
          "rsid": "rs769942899",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94988925,
          "rsid": "rs202201137",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 94988955,
          "rsid": "rs767284820",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 94988984,
          "rsid": "rs781583846",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 94989020,
          "rsid": "rs9332239",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 94989023,
          "rsid": "rs868182778",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [
        {
          "position": 94645745,
          "rsid": "rs12777823",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr7",
      "gene": "CYP3A4",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165819201",
              "alleles": [
                "G",
                "T",
                "G",
                "A",
                "T",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "A",
                "G",
                "T",
                "A",
                "G",
                "T",
                "C",
                "G",
                "A",
                "G",
                "T",
                "T",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "T",
                "T",
                "A",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C"
              ],
              "cpicAlleles": [
                "T",
                "T",
                "G",
                "A",
                "T",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "A",
                "G",
                "T",
                "A",
                "T",
                "T",
                "C",
                "G",
                "A",
                "G",
                "T",
                "T",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "T",
                "T",
                "A",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "99758183:G;99758228:T;99760836:G;99760901:A;99760956:T;99762047:G;99762054:A;99762069:T;99762177:G;99762186:C;99762206:G;99762234:C;99763877:A;99763909:G;99763925:T;99764003:A;99766411:G;99766424:T;99766439:C;99766440:G;99768360:A;99768371:G;99768424:T;99768447:T;99768458:A;99768470:G;99768693:G;99769769:C;99769781:C;99769804:C;99769805:G;99770165:C;99770166:G;99770196:T;99770202:T;99770217:A;99778079:C;99780036:G;99784018:G;99784038:A;99784075:G;99784078:C;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165819201",
              "alleles": [
                "G",
                "T",
                "G",
                "A",
                "T",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "A",
                "G",
                "T",
                "A",
                "G",
                "T",
                "C",
                "G",
                "A",
                "G",
                "T",
                "T",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "T",
                "T",
                "A",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C"
              ],
              "cpicAlleles": [
                "T",
                "T",
                "G",
                "A",
                "T",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "A",
                "G",
                "T",
                "A",
                "T",
                "T",
                "C",
                "G",
                "A",
                "G",
                "T",
                "T",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "T",
                "T",
                "A",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "99758183:G;99758228:T;99760836:G;99760901:A;99760956:T;99762047:G;99762054:A;99762069:T;99762177:G;99762186:C;99762206:G;99762234:C;99763877:A;99763909:G;99763925:T;99764003:A;99766411:G;99766424:T;99766439:C;99766440:G;99768360:A;99768371:G;99768424:T;99768447:T;99768458:A;99768470:G;99768693:G;99769769:C;99769781:C;99769804:C;99769805:G;99770165:C;99770166:G;99770196:T;99770202:T;99770217:A;99778079:C;99780036:G;99784018:G;99784038:A;99784075:G;99784078:C;"
            ]
          },
          "score": 84
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA165819201",
            "alleles": [
              "G",
              "T",
              "G",
              "A",
              "T",
              "G",
              "A",
              "T",
              "G",
              "C",
              "G",
              "C",
              "A",
              "G",
              "T",
              "A",
              "G",
              "T",
              "C",
              "G",
              "A",
              "G",
              "T",
              "T",
              "A",
              "G",
              "G",
              "C",
              "C",
              "C",
              "G",
              "C",
              "G",
              "T",
              "T",
              "A",
              "C",
              "G",
              "G",
              "A",
              "G",
              "C"
            ],
            "cpicAlleles": [
              "T",
              "T",
              "G",
              "A",
              "T",
              "G",
              "A",
              "T",
              "G",
              "C",
              "G",
              "C",
              "A",
              "G",
              "T",
              "A",
              "T",
              "T",
              "C",
              "G",
              "A",
              "G",
              "T",
              "T",
              "A",
              "G",
              "G",
              "C",
              "C",
              "C",
              "G",
              "C",
              "G",
              "T",
              "T",
              "A",
              "C",
              "G",
              "G",
              "A",
              "G",
              "C"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "99758183:G;99758228:T;99760836:G;99760901:A;99760956:T;99762047:G;99762054:A;99762069:T;99762177:G;99762186:C;99762206:G;99762234:C;99763877:A;99763909:G;99763925:T;99764003:A;99766411:G;99766424:T;99766439:C;99766440:G;99768360:A;99768371:G;99768424:T;99768447:T;99768458:A;99768470:G;99768693:G;99769769:C;99769781:C;99769804:C;99769805:G;99770165:C;99770166:G;99770196:T;99770202:T;99770217:A;99778079:C;99780036:G;99784018:G;99784038:A;99784075:G;99784078:C;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 99758183,
          "rsid": "rs67666821",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99758228,
          "rsid": "rs1584538410",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99760836,
          "rsid": "rs4986913",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99760901,
          "rsid": "rs4986910",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99760956,
          "rsid": "rs774109750",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99762047,
          "rsid": "rs4986909",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99762054,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99762069,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99762177,
          "rsid": "rs12721629",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99762186,
          "rsid": "rs756833413",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99762206,
          "rsid": "rs67784355",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99762234,
          "rsid": "rs1318364992",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99763877,
          "rsid": "rs368296206",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99763909,
          "rsid": "rs1303250043",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99763925,
          "rsid": "rs201821708",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99764003,
          "rsid": "rs28371759",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99766411,
          "rsid": "rs4646438",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99766424,
          "rsid": "rs1429705359",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99766439,
          "rsid": "rs145582851",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99766440,
          "rsid": "rs138105638",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99768360,
          "rsid": "rs55785340",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99768371,
          "rsid": "rs55901263",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99768424,
          "rsid": "rs113667357",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99768447,
          "rsid": "rs3208361",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99768458,
          "rsid": "rs4987161",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99768470,
          "rsid": "rs12721627",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99768693,
          "rsid": "rs35599367",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99769769,
          "rsid": "rs4986908",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99769781,
          "rsid": "rs72552798",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99769804,
          "rsid": "rs4986907",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99769805,
          "rsid": "rs57409622",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99770165,
          "rsid": "rs72552799",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99770166,
          "rsid": "rs778013004",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99770196,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99770202,
          "rsid": "rs55951658",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99770217,
          "rsid": "rs1449865051",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99778079,
          "rsid": "rs56324128",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99780036,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99784018,
          "rsid": "rs570051168",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99784038,
          "rsid": "rs12721634",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 99784075,
          "rsid": "rs188389063",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 99784078,
          "rsid": "rs1226205448",
          "vcfCall": "C|C",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr7",
      "gene": "CYP3A5",
      "diplotypes": [
        {
          "name": "*3/*3",
          "haplotype1": {
            "name": "*3",
            "haplotype": {
              "name": "*3",
              "id": "PA166128219",
              "alleles": [
                "T",
                "C",
                "C",
                "C",
                "G"
              ],
              "cpicAlleles": [
                "A",
                "C",
                "C",
                "C",
                "G"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "99652770:T;99660516:C;99665212:C;99672916:C;99676198:G;"
            ]
          },
          "haplotype2": {
            "name": "*3",
            "haplotype": {
              "name": "*3",
              "id": "PA166128219",
              "alleles": [
                "T",
                "C",
                "C",
                "C",
                "G"
              ],
              "cpicAlleles": [
                "A",
                "C",
                "C",
                "C",
                "G"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "99652770:T;99660516:C;99665212:C;99672916:C;99676198:G;"
            ]
          },
          "score": 2
        }
      ],
      "haplotypes": [
        {
          "name": "*3",
          "haplotype": {
            "name": "*3",
            "id": "PA166128219",
            "alleles": [
              "T",
              "C",
              "C",
              "C",
              "G"
            ],
            "cpicAlleles": [
              "A",
              "C",
              "C",
              "C",
              "G"
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "99652770:T;99660516:C;99665212:C;99672916:C;99676198:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": false,
      "variants": [
        {
          "position": 99652770,
          "rsid": "rs41303343",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 99660516,
          "rsid": "rs28383479",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99665212,
          "rsid": "rs10264272",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 99672916,
          "rsid": "rs776746",
          "vcfCall": "C/C",
          "phased": false
        },
        {
          "position": 99676198,
          "rsid": "rs55817950",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": false,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr19",
      "gene": "CYP4F2",
      "diplotypes": [
        {
          "name": "*4/*5",
          "haplotype1": {
            "name": "*4",
            "haplotype": {
              "name": "*4",
              "id": "PA166287623",
              "alleles": [
                "G",
                "T",
                "C",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "C"
              ],
              "cpicAlleles": [
                "G",
                "T",
                "C",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "C"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "15878779:G;15878920:T;15879412:C;15879621:T;15886018:G;15889671:C;15890405:C;15892541:C;15895527:G;15895560:G;15897466:C;15897473:G;15897566:C;15897578:C;"
            ]
          },
          "haplotype2": {
            "name": "*5",
            "haplotype": {
              "name": "*5",
              "id": "PA166287624",
              "alleles": [
                "T",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "A"
              ],
              "cpicAlleles": [
                "T",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "A"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "15878779:T;15878920:T;15879412:C;15879621:C;15886018:G;15889671:C;15890405:C;15892541:C;15895527:G;15895560:G;15897466:C;15897473:G;15897566:C;15897578:A;"
            ]
          },
          "score": 3
        }
      ],
      "haplotypes": [
        {
          "name": "*4",
          "haplotype": {
            "name": "*4",
            "id": "PA166287623",
            "alleles": [
              "G",
              "T",
              "C",
              "T",
              "G",
              "C",
              "C",
              "C",
              "G",
              "G",
              "C",
              "G",
              "C",
              "C"
            ],
            "cpicAlleles": [
              "G",
              "T",
              "C",
              "T",
              "G",
              "C",
              "C",
              "C",
              "G",
              "G",
              "C",
              "G",
              "C",
              "C"
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "15878779:G;15878920:T;15879412:C;15879621:T;15886018:G;15889671:C;15890405:C;15892541:C;15895527:G;15895560:G;15897466:C;15897473:G;15897566:C;15897578:C;"
          ]
        },
        {
          "name": "*5",
          "haplotype": {
            "name": "*5",
            "id": "PA166287624",
            "alleles": [
              "T",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "G",
              "C",
              "G",
              "C",
              "A"
            ],
            "cpicAlleles": [
              "T",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "G",
              "C",
              "G",
              "C",
              "A"
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "15878779:T;15878920:T;15879412:C;15879621:C;15886018:G;15889671:C;15890405:C;15892541:C;15895527:G;15895560:G;15897466:C;15897473:G;15897566:C;15897578:A;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 15878779,
          "rsid": "rs3093200",
          "vcfCall": "G|T",
          "phased": true
        },
        {
          "position": 15878920,
          "rsid": "rs4020346",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 15879412,
          "rsid": "rs138971789",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 15879621,
          "rsid": "rs2108622",
          "vcfCall": "T|C",
          "phased": true
        },
        {
          "position": 15886018,
          "rsid": "rs145174239",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 15889671,
          "rsid": "rs144233412",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 15890405,
          "rsid": "rs3093153",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 15892541,
          "rsid": "rs145875499",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 15895527,
          "rsid": "rs114396708",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 15895560,
          "rsid": "rs144455532",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 15897466,
          "rsid": "rs201380574",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 15897473,
          "rsid": "rs115517770",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 15897566,
          "rsid": "rs114099324",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 15897578,
          "rsid": "rs3093105",
          "vcfCall": "C|A",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": false,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr1",
      "gene": "DPYD",
      "diplotypes": [
        {
          "name": "Reference/Reference",
          "haplotype1": {
            "name": "Reference",
            "haplotype": {
              "name": "Reference",
              "id": "PA166171116",
              "alleles": [
                "G",
                "C",
                "C",
                "C",
                "A",
                "G",
                "T",
                "T",
                "T",
                "T",
                "T",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "G",
                "A",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "G",
                "TG",
                "A",
                "A",
                "C",
                "C",
                "G",
                "C",
                "A",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "G",
                "G",
                "G",
                "G",
                "A",
                "C",
                "C",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "G",
                "T",
                "T",
                "T",
                "C",
                "C",
                "T",
                "T",
                "T",
                "C",
                "GATGA",
                "A",
                "C",
                "G",
                "G"
              ],
              "cpicAlleles": [
                "G",
                "C",
                "C",
                "C",
                "A",
                "G",
                "T",
                "T",
                "T",
                "T",
                "T",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "G",
                "A",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "A",
                "C",
                "C",
                "G",
                "C",
                "A",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "G",
                "G",
                "G",
                "G",
                "A",
                "C",
                "C",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "G",
                "T",
                "T",
                "T",
                "C",
                "C",
                "T",
                "T",
                "T",
                "C",
                "ATGA(2)",
                "A",
                "C",
                "G",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "97078987:G;97078993:C;97079005:C;97079071:C;97079076:A;97079077:G;97079121:T;97079133:T;97079139:T;97082365:T;97082391:T;97098598:C;97098599:G;97098616:C;97098632:T;97193109:T;97193209:C;97234958:G;97234991:G;97305279:G;97305363:A;97305364:C;97305372:G;97306195:C;97373598:C;97373629:C;97382461:T;97450058:C;97450059:G;97450065:TG;97450068:A;97450168:A;97450187:C;97450189:C;97450190:G;97515784:C;97515787:A;97515839:T;97515851:C;97515865:C;97515889:G;97515923:C;97549565:C;97549600:T;97549609:G;97549681:G;97549713:G;97549726:G;97549735:G;97573785:A;97573805:C;97573821:C;97573839:A;97573881:C;97573918:C;97573919:G;97573943:C;97593238:T;97593289:G;97593322:C;97593343:C;97593379:C;97595083:G;97595088:A;97595149:T;97679170:T;97691776:G;97699399:T;97699430:T;97699474:T;97699506:C;97699533:C;97699535:T;97721542:T;97721650:T;97740400:C;97740410:GATGA;97883329:A;97883352:C;97883353:G;97883368:G;"
            ]
          },
          "haplotype2": {
            "name": "Reference",
            "haplotype": {
              "name": "Reference",
              "id": "PA166171116",
              "alleles": [
                "G",
                "C",
                "C",
                "C",
                "A",
                "G",
                "T",
                "T",
                "T",
                "T",
                "T",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "G",
                "A",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "G",
                "TG",
                "A",
                "A",
                "C",
                "C",
                "G",
                "C",
                "A",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "G",
                "G",
                "G",
                "G",
                "A",
                "C",
                "C",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "G",
                "T",
                "T",
                "T",
                "C",
                "C",
                "T",
                "T",
                "T",
                "C",
                "GATGA",
                "A",
                "C",
                "G",
                "G"
              ],
              "cpicAlleles": [
                "G",
                "C",
                "C",
                "C",
                "A",
                "G",
                "T",
                "T",
                "T",
                "T",
                "T",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "G",
                "A",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "A",
                "C",
                "C",
                "G",
                "C",
                "A",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "G",
                "G",
                "G",
                "G",
                "A",
                "C",
                "C",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "G",
                "T",
                "T",
                "T",
                "C",
                "C",
                "T",
                "T",
                "T",
                "C",
                "ATGA(2)",
                "A",
                "C",
                "G",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "97078987:G;97078993:C;97079005:C;97079071:C;97079076:A;97079077:G;97079121:T;97079133:T;97079139:T;97082365:T;97082391:T;97098598:C;97098599:G;97098616:C;97098632:T;97193109:T;97193209:C;97234958:G;97234991:G;97305279:G;97305363:A;97305364:C;97305372:G;97306195:C;97373598:C;97373629:C;97382461:T;97450058:C;97450059:G;97450065:TG;97450068:A;97450168:A;97450187:C;97450189:C;97450190:G;97515784:C;97515787:A;97515839:T;97515851:C;97515865:C;97515889:G;97515923:C;97549565:C;97549600:T;97549609:G;97549681:G;97549713:G;97549726:G;97549735:G;97573785:A;97573805:C;97573821:C;97573839:A;97573881:C;97573918:C;97573919:G;97573943:C;97593238:T;97593289:G;97593322:C;97593343:C;97593379:C;97595083:G;97595088:A;97595149:T;97679170:T;97691776:G;97699399:T;97699430:T;97699474:T;97699506:C;97699533:C;97699535:T;97721542:T;97721650:T;97740400:C;97740410:GATGA;97883329:A;97883352:C;97883353:G;97883368:G;"
            ]
          },
          "score": 162
        }
      ],
      "haplotypes": [
        {
          "name": "Reference",
          "haplotype": {
            "name": "Reference",
            "id": "PA166171116",
            "alleles": [
              "G",
              "C",
              "C",
              "C",
              "A",
              "G",
              "T",
              "T",
              "T",
              "T",
              "T",
              "C",
              "G",
              "C",
              "T",
              "T",
              "C",
              "G",
              "G",
              "G",
              "A",
              "C",
              "G",
              "C",
              "C",
              "C",
              "T",
              "C",
              "G",
              "TG",
              "A",
              "A",
              "C",
              "C",
              "G",
              "C",
              "A",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "T",
              "G",
              "G",
              "G",
              "G",
              "G",
              "A",
              "C",
              "C",
              "A",
              "C",
              "C",
              "G",
              "C",
              "T",
              "G",
              "C",
              "C",
              "C",
              "G",
              "A",
              "T",
              "T",
              "G",
              "T",
              "T",
              "T",
              "C",
              "C",
              "T",
              "T",
              "T",
              "C",
              "GATGA",
              "A",
              "C",
              "G",
              "G"
            ],
            "cpicAlleles": [
              "G",
              "C",
              "C",
              "C",
              "A",
              "G",
              "T",
              "T",
              "T",
              "T",
              "T",
              "C",
              "G",
              "C",
              "T",
              "T",
              "C",
              "G",
              "G",
              "G",
              "A",
              "C",
              "G",
              "C",
              "C",
              "C",
              "T",
              "C",
              "G",
              "G",
              "A",
              "A",
              "C",
              "C",
              "G",
              "C",
              "A",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "T",
              "G",
              "G",
              "G",
              "G",
              "G",
              "A",
              "C",
              "C",
              "A",
              "C",
              "C",
              "G",
              "C",
              "T",
              "G",
              "C",
              "C",
              "C",
              "G",
              "A",
              "T",
              "T",
              "G",
              "T",
              "T",
              "T",
              "C",
              "C",
              "T",
              "T",
              "T",
              "C",
              "ATGA(2)",
              "A",
              "C",
              "G",
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "97078987:G;97078993:C;97079005:C;97079071:C;97079076:A;97079077:G;97079121:T;97079133:T;97079139:T;97082365:T;97082391:T;97098598:C;97098599:G;97098616:C;97098632:T;97193109:T;97193209:C;97234958:G;97234991:G;97305279:G;97305363:A;97305364:C;97305372:G;97306195:C;97373598:C;97373629:C;97382461:T;97450058:C;97450059:G;97450065:TG;97450068:A;97450168:A;97450187:C;97450189:C;97450190:G;97515784:C;97515787:A;97515839:T;97515851:C;97515865:C;97515889:G;97515923:C;97549565:C;97549600:T;97549609:G;97549681:G;97549713:G;97549726:G;97549735:G;97573785:A;97573805:C;97573821:C;97573839:A;97573881:C;97573918:C;97573919:G;97573943:C;97593238:T;97593289:G;97593322:C;97593343:C;97593379:C;97595083:G;97595088:A;97595149:T;97679170:T;97691776:G;97699399:T;97699430:T;97699474:T;97699506:C;97699533:C;97699535:T;97721542:T;97721650:T;97740400:C;97740410:GATGA;97883329:A;97883352:C;97883353:G;97883368:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 97078987,
          "rsid": "rs114096998",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97078993,
          "rsid": "rs148799944",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97079005,
          "rsid": "rs140114515",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97079071,
          "rsid": "rs1801268",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97079076,
          "rsid": "rs139459586",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97079077,
          "rsid": "rs202144771",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97079121,
          "rsid": "rs72547601",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97079133,
          "rsid": "rs72547602",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97079139,
          "rsid": "rs145529148",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97082365,
          "rsid": "rs141044036",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97082391,
          "rsid": "rs67376798",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97098598,
          "rsid": "rs1801267",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97098599,
          "rsid": "rs147545709",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97098616,
          "rsid": "rs55674432",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97098632,
          "rsid": "rs201035051",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97193109,
          "rsid": "rs60139309",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97193209,
          "rsid": "rs200687447",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97234958,
          "rsid": "rs199634007",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97234991,
          "rsid": "rs56005131",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97305279,
          "rsid": "rs112766203",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97305363,
          "rsid": "rs60511679",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97305364,
          "rsid": "rs1801160",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97305372,
          "rsid": "rs146529561",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97306195,
          "rsid": "rs145548112",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97373598,
          "rsid": "rs137999090",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97373629,
          "rsid": "rs138545885",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97382461,
          "rsid": "rs55971861",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97450058,
          "rsid": "rs3918290",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97450059,
          "rsid": "rs3918289",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97450065,
          "rsid": "rs72549303",
          "vcfCall": "TG|TG",
          "phased": true
        },
        {
          "position": 97450068,
          "rsid": "rs17376848",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97450168,
          "rsid": "rs147601618",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97450187,
          "rsid": "rs145773863",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97450189,
          "rsid": "rs138616379",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97450190,
          "rsid": "rs59086055",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97515784,
          "rsid": "rs201615754",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97515787,
          "rsid": "rs55886062",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97515839,
          "rsid": "rs1801159",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97515851,
          "rsid": "rs142619737",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97515865,
          "rsid": "rs1801158",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97515889,
          "rsid": "rs190951787",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97515923,
          "rsid": "rs148994843",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97549565,
          "rsid": "rs138391898",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97549600,
          "rsid": "rs111858276",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97549609,
          "rsid": "rs72549304",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97549681,
          "rsid": "rs199549923",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97549713,
          "rsid": "rs57918000",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97549726,
          "rsid": "rs144395748",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97549735,
          "rsid": "rs72975710",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97573785,
          "rsid": "rs186169810",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97573805,
          "rsid": "rs142512579",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97573821,
          "rsid": "rs764666241",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97573839,
          "rsid": "rs200064537",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97573863,
          "rsid": "rs56038477",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97573881,
          "rsid": "rs61622928",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97573918,
          "rsid": "rs143815742",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97573919,
          "rsid": "rs140602333",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97573943,
          "rsid": "rs78060119",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97579893,
          "rsid": "rs75017182",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97593238,
          "rsid": "rs72549305",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97593289,
          "rsid": "rs143154602",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97593322,
          "rsid": "rs183385770",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97593343,
          "rsid": "rs72549306",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97593379,
          "rsid": "rs201018345",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97595083,
          "rsid": "rs145112791",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97595088,
          "rsid": "rs150437414",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97595149,
          "rsid": "rs146356975",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97679170,
          "rsid": "rs45589337",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97691776,
          "rsid": "rs1801266",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97699399,
          "rsid": "rs72549307",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97699430,
          "rsid": "rs72549308",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97699474,
          "rsid": "rs115232898",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97699506,
          "rsid": "rs6670886",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97699533,
          "rsid": "rs139834141",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97699535,
          "rsid": "rs2297595",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97721542,
          "rsid": "rs200562975",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97721650,
          "rsid": "rs141462178",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 97740400,
          "rsid": "rs150385342",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97740410,
          "rsid": "rs72549309",
          "vcfCall": "GATGA|GATGA",
          "phased": true
        },
        {
          "position": 97883329,
          "rsid": "rs1801265",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 97883352,
          "rsid": "rs80081766",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 97883353,
          "rsid": "rs72549310",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 97883368,
          "rsid": "rs150036960",
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": []
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chrX",
      "gene": "G6PD",
      "diplotypes": [
        {
          "name": "B (reference)/B (reference)",
          "haplotype1": {
            "name": "B (reference)",
            "haplotype": {
              "name": "B (reference)",
              "id": "PA165947826",
              "alleles": [
                "A",
                "CTCT",
                "G",
                "G",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "C",
                "A",
                "C",
                "G",
                "G",
                "C",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "C",
                "G",
                "T",
                "G",
                "C",
                "A",
                "A",
                "A",
                "T",
                "C",
                "CGGCCTTGCGCTCGTTCAG",
                "T",
                "G",
                "G",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "T",
                "G",
                "C",
                "C",
                "CGTGGGGTCGTCCAGGTACCCTTTG",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "C",
                "T",
                "G",
                "A",
                "G",
                "C",
                "T",
                "C",
                "C",
                "C",
                "G",
                "TCAGTGC",
                "T",
                "G",
                "C",
                "ATGT",
                "C",
                "G",
                "A",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "GGGA",
                "G",
                "G",
                "T",
                "T",
                "T",
                "G",
                "A",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "A",
                "C",
                "A",
                "G",
                "C",
                "GCTT",
                "G",
                "C",
                "G",
                "A",
                "T",
                "A",
                "C",
                "A",
                "G",
                "CAGA",
                "A",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "G",
                "C",
                "CATG",
                "A",
                "T",
                "T",
                "C",
                "C",
                "G"
              ],
              "cpicAlleles": [
                "A",
                "TTC",
                "G",
                "G",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "C",
                "A",
                "C",
                "G",
                "G",
                "C",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "C",
                "G",
                "T",
                "G",
                "C",
                "A",
                "A",
                "A",
                "T",
                "C",
                "GGCCTTGCGCTCGTTCAG",
                "T",
                "G",
                "G",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "T",
                "G",
                "C",
                "C",
                "GGGGTCGTCCAGGTACCCTTTGGT",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "C",
                "T",
                "G",
                "A",
                "G",
                "C",
                "T",
                "C",
                "C",
                "C",
                "G",
                "AGTGCC",
                "T",
                "G",
                "C",
                "TGT",
                "C",
                "G",
                "A",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "GAG",
                "G",
                "G",
                "T",
                "T",
                "T",
                "G",
                "A",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "A",
                "C",
                "A",
                "G",
                "C",
                "TCT",
                "G",
                "C",
                "G",
                "A",
                "T",
                "A",
                "C",
                "A",
                "G",
                "AGA",
                "A",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "G",
                "C",
                "GAT",
                "A",
                "T",
                "T",
                "C",
                "C",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "154532046:A;154532055:CTCT;154532082:G;154532083:G;154532085:C;154532086:C;154532203:G;154532231:T;154532245:G;154532257:C;154532258:G;154532264:C;154532265:C;154532269:C;154532278:T;154532279:C;154532389:C;154532390:G;154532392:A;154532403:C;154532408:T;154532411:C;154532432:G;154532434:C;154532458:A;154532459:C;154532570:G;154532590:G;154532608:C;154532623:T;154532625:C;154532626:C;154532628:G;154532629:G;154532634:T;154532639:C;154532649:G;154532661:T;154532662:C;154532667:G;154532674:C;154532676:C;154532677:G;154532679:A;154532688:T;154532692:T;154532694:C;154532695:G;154532698:T;154532699:G;154532700:C;154532701:A;154532713:A;154532715:A;154532716:T;154532722:C;154532752:CGGCCTTGCGCTCGTTCAG;154532758:T;154532765:G;154532772:G;154532773:C;154532797:G;154532802:C;154532945:C;154532956:T;154532969:G;154532987:T;154532989:G;154532990:C;154533004:C;154533012:CGTGGGGTCGTCCAGGTACCCTTTG;154533016:G;154533025:A;154533029:A;154533031:C;154533044:C;154533064:C;154533072:C;154533077:C;154533083:C;154533122:C;154533586:C;154533587:G;154533589:A;154533591:G;154533592:T;154533596:C;154533605:T;154533607:G;154533608:A;154533614:G;154533615:C;154533619:T;154533620:C;154533629:C;154533634:C;154534036:G;154534074:TCAGTGC;154534092:T;154534102:G;154534110:C;154534116:ATGT;154534125:C;154534126:G;154534157:A;154534345:C;154534348:T;154534387:T;154534389:C;154534390:G;154534409:G;154534414:GGGA;154534419:G;154534438:G;154534440:T;154534447:T;154534455:T;154534463:G;154534465:A;154534468:G;154534485:C;154534486:G;154534489:T;154534494:C;154534495:C;154535176:C;154535180:C;154535187:C;154535190:G;154535211:C;154535244:G;154535247:G;154535249:T;154535261:C;154535269:G;154535270:A;154535274:C;154535277:T;154535278:C;154535301:A;154535316:C;154535330:A;154535336:G;154535342:C;154535367:GCTT;154535379:G;154535962:C;154535963:G;154535980:A;154535995:T;154535996:A;154536002:C;154536008:A;154536019:G;154536021:CAGA;154536025:A;154536032:C;154536034:C;154536035:G;154536045:C;154536151:G;154536156:A;154536168:G;154536169:C;154546045:CATG;154546046:A;154546057:T;154546061:T;154546116:C;154546122:C;154546131:G;"
            ]
          },
          "haplotype2": {
            "name": "B (reference)",
            "haplotype": {
              "name": "B (reference)",
              "id": "PA165947826",
              "alleles": [
                "A",
                "CTCT",
                "G",
                "G",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "C",
                "A",
                "C",
                "G",
                "G",
                "C",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "C",
                "G",
                "T",
                "G",
                "C",
                "A",
                "A",
                "A",
                "T",
                "C",
                "CGGCCTTGCGCTCGTTCAG",
                "T",
                "G",
                "G",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "T",
                "G",
                "C",
                "C",
                "CGTGGGGTCGTCCAGGTACCCTTTG",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "C",
                "T",
                "G",
                "A",
                "G",
                "C",
                "T",
                "C",
                "C",
                "C",
                "G",
                "TCAGTGC",
                "T",
                "G",
                "C",
                "ATGT",
                "C",
                "G",
                "A",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "GGGA",
                "G",
                "G",
                "T",
                "T",
                "T",
                "G",
                "A",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "A",
                "C",
                "A",
                "G",
                "C",
                "GCTT",
                "G",
                "C",
                "G",
                "A",
                "T",
                "A",
                "C",
                "A",
                "G",
                "CAGA",
                "A",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "G",
                "C",
                "CATG",
                "A",
                "T",
                "T",
                "C",
                "C",
                "G"
              ],
              "cpicAlleles": [
                "A",
                "TTC",
                "G",
                "G",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "T",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "C",
                "A",
                "C",
                "G",
                "G",
                "C",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "T",
                "T",
                "C",
                "G",
                "T",
                "G",
                "C",
                "A",
                "A",
                "A",
                "T",
                "C",
                "GGCCTTGCGCTCGTTCAG",
                "T",
                "G",
                "G",
                "C",
                "G",
                "C",
                "C",
                "T",
                "G",
                "T",
                "G",
                "C",
                "C",
                "GGGGTCGTCCAGGTACCCTTTGGT",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "C",
                "T",
                "G",
                "A",
                "G",
                "C",
                "T",
                "C",
                "C",
                "C",
                "G",
                "AGTGCC",
                "T",
                "G",
                "C",
                "TGT",
                "C",
                "G",
                "A",
                "C",
                "T",
                "T",
                "C",
                "G",
                "G",
                "GAG",
                "G",
                "G",
                "T",
                "T",
                "T",
                "G",
                "A",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "C",
                "G",
                "C",
                "G",
                "G",
                "T",
                "C",
                "G",
                "A",
                "C",
                "T",
                "C",
                "A",
                "C",
                "A",
                "G",
                "C",
                "TCT",
                "G",
                "C",
                "G",
                "A",
                "T",
                "A",
                "C",
                "A",
                "G",
                "AGA",
                "A",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "G",
                "C",
                "GAT",
                "A",
                "T",
                "T",
                "C",
                "C",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "154532046:A;154532055:CTCT;154532082:G;154532083:G;154532085:C;154532086:C;154532203:G;154532231:T;154532245:G;154532257:C;154532258:G;154532264:C;154532265:C;154532269:C;154532278:T;154532279:C;154532389:C;154532390:G;154532392:A;154532403:C;154532408:T;154532411:C;154532432:G;154532434:C;154532458:A;154532459:C;154532570:G;154532590:G;154532608:C;154532623:T;154532625:C;154532626:C;154532628:G;154532629:G;154532634:T;154532639:C;154532649:G;154532661:T;154532662:C;154532667:G;154532674:C;154532676:C;154532677:G;154532679:A;154532688:T;154532692:T;154532694:C;154532695:G;154532698:T;154532699:G;154532700:C;154532701:A;154532713:A;154532715:A;154532716:T;154532722:C;154532752:CGGCCTTGCGCTCGTTCAG;154532758:T;154532765:G;154532772:G;154532773:C;154532797:G;154532802:C;154532945:C;154532956:T;154532969:G;154532987:T;154532989:G;154532990:C;154533004:C;154533012:CGTGGGGTCGTCCAGGTACCCTTTG;154533016:G;154533025:A;154533029:A;154533031:C;154533044:C;154533064:C;154533072:C;154533077:C;154533083:C;154533122:C;154533586:C;154533587:G;154533589:A;154533591:G;154533592:T;154533596:C;154533605:T;154533607:G;154533608:A;154533614:G;154533615:C;154533619:T;154533620:C;154533629:C;154533634:C;154534036:G;154534074:TCAGTGC;154534092:T;154534102:G;154534110:C;154534116:ATGT;154534125:C;154534126:G;154534157:A;154534345:C;154534348:T;154534387:T;154534389:C;154534390:G;154534409:G;154534414:GGGA;154534419:G;154534438:G;154534440:T;154534447:T;154534455:T;154534463:G;154534465:A;154534468:G;154534485:C;154534486:G;154534489:T;154534494:C;154534495:C;154535176:C;154535180:C;154535187:C;154535190:G;154535211:C;154535244:G;154535247:G;154535249:T;154535261:C;154535269:G;154535270:A;154535274:C;154535277:T;154535278:C;154535301:A;154535316:C;154535330:A;154535336:G;154535342:C;154535367:GCTT;154535379:G;154535962:C;154535963:G;154535980:A;154535995:T;154535996:A;154536002:C;154536008:A;154536019:G;154536021:CAGA;154536025:A;154536032:C;154536034:C;154536035:G;154536045:C;154536151:G;154536156:A;154536168:G;154536169:C;154546045:CATG;154546046:A;154546057:T;154546061:T;154546116:C;154546122:C;154546131:G;"
            ]
          },
          "score": 342
        }
      ],
      "haplotypes": [
        {
          "name": "B (reference)",
          "haplotype": {
            "name": "B (reference)",
            "id": "PA165947826",
            "alleles": [
              "A",
              "CTCT",
              "G",
              "G",
              "C",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "C",
              "C",
              "C",
              "T",
              "C",
              "C",
              "G",
              "A",
              "C",
              "T",
              "C",
              "G",
              "C",
              "A",
              "C",
              "G",
              "G",
              "C",
              "T",
              "C",
              "C",
              "G",
              "G",
              "T",
              "C",
              "G",
              "T",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "T",
              "T",
              "C",
              "G",
              "T",
              "G",
              "C",
              "A",
              "A",
              "A",
              "T",
              "C",
              "CGGCCTTGCGCTCGTTCAG",
              "T",
              "G",
              "G",
              "C",
              "G",
              "C",
              "C",
              "T",
              "G",
              "T",
              "G",
              "C",
              "C",
              "CGTGGGGTCGTCCAGGTACCCTTTG",
              "G",
              "A",
              "A",
              "C",
              "C",
              "C",
              "C",
              "C",
              "C",
              "C",
              "C",
              "G",
              "A",
              "G",
              "T",
              "C",
              "T",
              "G",
              "A",
              "G",
              "C",
              "T",
              "C",
              "C",
              "C",
              "G",
              "TCAGTGC",
              "T",
              "G",
              "C",
              "ATGT",
              "C",
              "G",
              "A",
              "C",
              "T",
              "T",
              "C",
              "G",
              "G",
              "GGGA",
              "G",
              "G",
              "T",
              "T",
              "T",
              "G",
              "A",
              "G",
              "C",
              "G",
              "T",
              "C",
              "C",
              "C",
              "C",
              "C",
              "G",
              "C",
              "G",
              "G",
              "T",
              "C",
              "G",
              "A",
              "C",
              "T",
              "C",
              "A",
              "C",
              "A",
              "G",
              "C",
              "GCTT",
              "G",
              "C",
              "G",
              "A",
              "T",
              "A",
              "C",
              "A",
              "G",
              "CAGA",
              "A",
              "C",
              "C",
              "G",
              "C",
              "G",
              "A",
              "G",
              "C",
              "CATG",
              "A",
              "T",
              "T",
              "C",
              "C",
              "G"
            ],
            "cpicAlleles": [
              "A",
              "TTC",
              "G",
              "G",
              "C",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "C",
              "C",
              "C",
              "T",
              "C",
              "C",
              "G",
              "A",
              "C",
              "T",
              "C",
              "G",
              "C",
              "A",
              "C",
              "G",
              "G",
              "C",
              "T",
              "C",
              "C",
              "G",
              "G",
              "T",
              "C",
              "G",
              "T",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "T",
              "T",
              "C",
              "G",
              "T",
              "G",
              "C",
              "A",
              "A",
              "A",
              "T",
              "C",
              "GGCCTTGCGCTCGTTCAG",
              "T",
              "G",
              "G",
              "C",
              "G",
              "C",
              "C",
              "T",
              "G",
              "T",
              "G",
              "C",
              "C",
              "GGGGTCGTCCAGGTACCCTTTGGT",
              "G",
              "A",
              "A",
              "C",
              "C",
              "C",
              "C",
              "C",
              "C",
              "C",
              "C",
              "G",
              "A",
              "G",
              "T",
              "C",
              "T",
              "G",
              "A",
              "G",
              "C",
              "T",
              "C",
              "C",
              "C",
              "G",
              "AGTGCC",
              "T",
              "G",
              "C",
              "TGT",
              "C",
              "G",
              "A",
              "C",
              "T",
              "T",
              "C",
              "G",
              "G",
              "GAG",
              "G",
              "G",
              "T",
              "T",
              "T",
              "G",
              "A",
              "G",
              "C",
              "G",
              "T",
              "C",
              "C",
              "C",
              "C",
              "C",
              "G",
              "C",
              "G",
              "G",
              "T",
              "C",
              "G",
              "A",
              "C",
              "T",
              "C",
              "A",
              "C",
              "A",
              "G",
              "C",
              "TCT",
              "G",
              "C",
              "G",
              "A",
              "T",
              "A",
              "C",
              "A",
              "G",
              "AGA",
              "A",
              "C",
              "C",
              "G",
              "C",
              "G",
              "A",
              "G",
              "C",
              "GAT",
              "A",
              "T",
              "T",
              "C",
              "C",
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "154532046:A;154532055:CTCT;154532082:G;154532083:G;154532085:C;154532086:C;154532203:G;154532231:T;154532245:G;154532257:C;154532258:G;154532264:C;154532265:C;154532269:C;154532278:T;154532279:C;154532389:C;154532390:G;154532392:A;154532403:C;154532408:T;154532411:C;154532432:G;154532434:C;154532458:A;154532459:C;154532570:G;154532590:G;154532608:C;154532623:T;154532625:C;154532626:C;154532628:G;154532629:G;154532634:T;154532639:C;154532649:G;154532661:T;154532662:C;154532667:G;154532674:C;154532676:C;154532677:G;154532679:A;154532688:T;154532692:T;154532694:C;154532695:G;154532698:T;154532699:G;154532700:C;154532701:A;154532713:A;154532715:A;154532716:T;154532722:C;154532752:CGGCCTTGCGCTCGTTCAG;154532758:T;154532765:G;154532772:G;154532773:C;154532797:G;154532802:C;154532945:C;154532956:T;154532969:G;154532987:T;154532989:G;154532990:C;154533004:C;154533012:CGTGGGGTCGTCCAGGTACCCTTTG;154533016:G;154533025:A;154533029:A;154533031:C;154533044:C;154533064:C;154533072:C;154533077:C;154533083:C;154533122:C;154533586:C;154533587:G;154533589:A;154533591:G;154533592:T;154533596:C;154533605:T;154533607:G;154533608:A;154533614:G;154533615:C;154533619:T;154533620:C;154533629:C;154533634:C;154534036:G;154534074:TCAGTGC;154534092:T;154534102:G;154534110:C;154534116:ATGT;154534125:C;154534126:G;154534157:A;154534345:C;154534348:T;154534387:T;154534389:C;154534390:G;154534409:G;154534414:GGGA;154534419:G;154534438:G;154534440:T;154534447:T;154534455:T;154534463:G;154534465:A;154534468:G;154534485:C;154534486:G;154534489:T;154534494:C;154534495:C;154535176:C;154535180:C;154535187:C;154535190:G;154535211:C;154535244:G;154535247:G;154535249:T;154535261:C;154535269:G;154535270:A;154535274:C;154535277:T;154535278:C;154535301:A;154535316:C;154535330:A;154535336:G;154535342:C;154535367:GCTT;154535379:G;154535962:C;154535963:G;154535980:A;154535995:T;154535996:A;154536002:C;154536008:A;154536019:G;154536021:CAGA;154536025:A;154536032:C;154536034:C;154536035:G;154536045:C;154536151:G;154536156:A;154536168:G;154536169:C;154546045:CATG;154546046:A;154546057:T;154546061:T;154546116:C;154546122:C;154546131:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 154532046,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532055,
          "rsid": null,
          "vcfCall": "CTCT|CTCT",
          "phased": true
        },
        {
          "position": 154532082,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532083,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532085,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532086,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532203,
          "rsid": "rs137852348",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532231,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532245,
          "rsid": "rs137852344",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532257,
          "rsid": "rs72554664",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532258,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532264,
          "rsid": "rs782608284",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532265,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532269,
          "rsid": "rs72554665",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532278,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532279,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532389,
          "rsid": "rs137852324",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532390,
          "rsid": "rs398123546",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532392,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532403,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532408,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532411,
          "rsid": "rs137852317",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532432,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532434,
          "rsid": "rs137852337",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532458,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532459,
          "rsid": "rs782098548",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532570,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532590,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532608,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532623,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532625,
          "rsid": "rs137852336",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532626,
          "rsid": "rs137852323",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532628,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532629,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532634,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532639,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532649,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532661,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532662,
          "rsid": "rs137852325",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532667,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532674,
          "rsid": "rs137852335",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532676,
          "rsid": "rs137852316",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532677,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532679,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532688,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532692,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532694,
          "rsid": "rs137852321",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532695,
          "rsid": "rs137852334",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532698,
          "rsid": "rs137852320",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532699,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532700,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532701,
          "rsid": "rs137852322",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532713,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532715,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154532716,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532722,
          "rsid": "rs371489738",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532752,
          "rsid": null,
          "vcfCall": "CGGCCTTGCGCTCGTTCAG|CGGCCTTGCGCTCGTTCAG",
          "phased": true
        },
        {
          "position": 154532758,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532765,
          "rsid": "rs137852329",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532772,
          "rsid": "rs137852345",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532773,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532797,
          "rsid": "rs137852333",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532802,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532945,
          "rsid": "rs34193178",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154532956,
          "rsid": "rs398123544",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532969,
          "rsid": "rs137852342",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532987,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154532989,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154532990,
          "rsid": "rs5030869",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533004,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533012,
          "rsid": null,
          "vcfCall": "CGTGGGGTCGTCCAGGTACCCTTTG|CGTGGGGTCGTCCAGGTACCCTTTG",
          "phased": true
        },
        {
          "position": 154533016,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154533025,
          "rsid": "rs76723693",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154533029,
          "rsid": "rs137852347",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154533031,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533044,
          "rsid": "rs137852339",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533064,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533072,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533077,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533083,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533122,
          "rsid": "rs137852327",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533586,
          "rsid": "rs74575103",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533587,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154533589,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154533591,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154533592,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154533596,
          "rsid": "rs137852318",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533605,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154533607,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154533608,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154533614,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154533615,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533619,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154533620,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533629,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154533634,
          "rsid": "rs137852346",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534036,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534074,
          "rsid": null,
          "vcfCall": "TCAGTGC|TCAGTGC",
          "phased": true
        },
        {
          "position": 154534092,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534102,
          "rsid": "rs782757170",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534110,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534116,
          "rsid": null,
          "vcfCall": "ATGT|ATGT",
          "phased": true
        },
        {
          "position": 154534125,
          "rsid": "rs137852328",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534126,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534157,
          "rsid": "rs137852319",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154534345,
          "rsid": "rs137852326",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534348,
          "rsid": "rs782754619",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534387,
          "rsid": "rs781865768",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534389,
          "rsid": "rs137852332",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534390,
          "rsid": "rs137852330",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534409,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534414,
          "rsid": null,
          "vcfCall": "GGGA|GGGA",
          "phased": true
        },
        {
          "position": 154534419,
          "rsid": "rs5030868",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534438,
          "rsid": "rs267606836",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534440,
          "rsid": "rs5030872",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534447,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534455,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534463,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534465,
          "rsid": "rs137852343",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154534468,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534485,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534486,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154534489,
          "rsid": "rs137852331",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154534494,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154534495,
          "rsid": "rs137852314",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535176,
          "rsid": "rs370918918",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535180,
          "rsid": "rs782487723",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535187,
          "rsid": "rs137852313",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535190,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535211,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535244,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535247,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535249,
          "rsid": "rs782322505",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154535261,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535269,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535270,
          "rsid": "rs78365220",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154535274,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535277,
          "rsid": "rs1050829",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154535278,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535301,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154535316,
          "rsid": "rs5030870",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535330,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154535336,
          "rsid": "rs267606835",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535342,
          "rsid": "rs181277621",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535367,
          "rsid": null,
          "vcfCall": "GCTT|GCTT",
          "phased": true
        },
        {
          "position": 154535379,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535962,
          "rsid": "rs782308266",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154535963,
          "rsid": "rs138687036",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154535980,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154535995,
          "rsid": "rs782090947",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154535996,
          "rsid": "rs137852349",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154536002,
          "rsid": "rs1050828",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154536008,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154536019,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154536021,
          "rsid": null,
          "vcfCall": "CAGA|CAGA",
          "phased": true
        },
        {
          "position": 154536025,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154536032,
          "rsid": "rs137852315",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154536034,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154536035,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154536045,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154536151,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154536156,
          "rsid": "rs76645461",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154536168,
          "rsid": "rs78478128",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 154536169,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154546045,
          "rsid": "rs137852338",
          "vcfCall": "CATG|CATG",
          "phased": true
        },
        {
          "position": 154546046,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 154546057,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154546061,
          "rsid": "rs137852340",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 154546116,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154546122,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 154546131,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr19",
      "gene": "IFNL3",
      "diplotypes": [
        {
          "name": "rs12979860 reference (C)/rs12979860 reference (C)",
          "haplotype1": {
            "name": "rs12979860 reference (C)",
            "haplotype": {
              "name": "rs12979860 reference (C)",
              "id": "PA166129427",
              "alleles": [
                "C"
              ],
              "cpicAlleles": [
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "39248147:C;"
            ]
          },
          "haplotype2": {
            "name": "rs12979860 reference (C)",
            "haplotype": {
              "name": "rs12979860 reference (C)",
              "id": "PA166129427",
              "alleles": [
                "C"
              ],
              "cpicAlleles": [
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "39248147:C;"
            ]
          },
          "score": 2
        }
      ],
      "haplotypes": [
        {
          "name": "rs12979860 reference (C)",
          "haplotype": {
            "name": "rs12979860 reference (C)",
            "id": "PA166129427",
            "alleles": [
              "C"
            ],
            "cpicAlleles": [
              "C"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "39248147:C;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 39248147,
          "rsid": "rs12979860",
          "vcfCall": "C|C",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr13",
      "gene": "NUDT15",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA166131619",
              "alleles": [
                "T",
                "G",
                "AGGAGTC",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "C",
                "GA",
                "T",
                "G",
                "C",
                "C",
                "G",
                "T"
              ],
              "cpicAlleles": [
                "T",
                "G",
                "GAGTCG(3)",
                "G",
                "del",
                "C",
                "G",
                "A",
                "G",
                "C",
                "A",
                "G",
                "G",
                "C",
                "C",
                "G",
                "T"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "48037748:T;48037749:G;48037782:AGGAGTC;48037798:G;48037825:C;48037834:C;48037847:G;48037849:A;48037885:G;48037902:C;48040977:GA;48041103:T;48041113:G;48045690:C;48045719:C;48045720:G;48045771:T;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA166131619",
              "alleles": [
                "T",
                "G",
                "AGGAGTC",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "C",
                "GA",
                "T",
                "G",
                "C",
                "C",
                "G",
                "T"
              ],
              "cpicAlleles": [
                "T",
                "G",
                "GAGTCG(3)",
                "G",
                "del",
                "C",
                "G",
                "A",
                "G",
                "C",
                "A",
                "G",
                "G",
                "C",
                "C",
                "G",
                "T"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "48037748:T;48037749:G;48037782:AGGAGTC;48037798:G;48037825:C;48037834:C;48037847:G;48037849:A;48037885:G;48037902:C;48040977:GA;48041103:T;48041113:G;48045690:C;48045719:C;48045720:G;48045771:T;"
            ]
          },
          "score": 34
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA166131619",
            "alleles": [
              "T",
              "G",
              "AGGAGTC",
              "G",
              "C",
              "C",
              "G",
              "A",
              "G",
              "C",
              "GA",
              "T",
              "G",
              "C",
              "C",
              "G",
              "T"
            ],
            "cpicAlleles": [
              "T",
              "G",
              "GAGTCG(3)",
              "G",
              "del",
              "C",
              "G",
              "A",
              "G",
              "C",
              "A",
              "G",
              "G",
              "C",
              "C",
              "G",
              "T"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "48037748:T;48037749:G;48037782:AGGAGTC;48037798:G;48037825:C;48037834:C;48037847:G;48037849:A;48037885:G;48037902:C;48040977:GA;48041103:T;48041113:G;48045690:C;48045719:C;48045720:G;48045771:T;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 48037748,
          "rsid": "rs769369441",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 48037749,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 48037782,
          "rsid": "rs746071566",
          "vcfCall": "AGGAGTC|AGGAGTC",
          "phased": true
        },
        {
          "position": 48037798,
          "rsid": "rs186364861",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 48037825,
          "rsid": "rs777311140",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 48037834,
          "rsid": "rs1202487323",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 48037847,
          "rsid": "rs766023281",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 48037849,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 48037885,
          "rsid": "rs1950545307",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 48037902,
          "rsid": "rs149436418",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 48040977,
          "rsid": "rs1457579126",
          "vcfCall": "GA|GA",
          "phased": true
        },
        {
          "position": 48041103,
          "rsid": "rs761191455",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 48041113,
          "rsid": "rs1368252918",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 48045690,
          "rsid": "rs768324690",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 48045719,
          "rsid": "rs116855232",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 48045720,
          "rsid": "rs147390019",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 48045771,
          "rsid": "rs139551410",
          "vcfCall": "T|T",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr19",
      "gene": "RYR1",
      "diplotypes": [
        {
          "name": "Reference/Reference",
          "haplotype1": {
            "name": "Reference",
            "haplotype": {
              "name": "Reference",
              "id": "PA166180377",
              "alleles": [
                "T",
                "CGAT",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "A",
                "G",
                "C",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "C",
                "T",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "A",
                "G",
                "A",
                "A",
                "A",
                "A",
                "C",
                "C",
                "C",
                "T",
                "A",
                "G",
                "A",
                "C",
                "T",
                "C",
                "T",
                "C",
                "A",
                "T",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "TGGA",
                "A",
                "G",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "A",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "T",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "C",
                "A",
                "T",
                "G",
                "G",
                "T",
                "T",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "C",
                "A",
                "A",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "A",
                "T",
                "A",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "G",
                "A",
                "C",
                "A",
                "C",
                "T",
                "G",
                "G",
                "G",
                "T",
                "G",
                "A",
                "C",
                "C",
                "A",
                "G",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "TC",
                "C",
                "T",
                "C",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "G",
                "G",
                "A",
                "TT",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "T",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "A",
                "G",
                "G"
              ],
              "cpicAlleles": [
                "T",
                "TGA",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "A",
                "G",
                "C",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "C",
                "del",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "A",
                "G",
                "A",
                "A",
                "A",
                "A",
                "C",
                "C",
                "C",
                "T",
                "A",
                "G",
                "A",
                "C",
                "T",
                "C",
                "T",
                "C",
                "A",
                "T",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "GAG",
                "A",
                "G",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "A",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "T",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "C",
                "A",
                "T",
                "G",
                "G",
                "T",
                "T",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "C",
                "A",
                "A",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "A",
                "T",
                "A",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "G",
                "A",
                "C",
                "A",
                "C",
                "T",
                "G",
                "G",
                "G",
                "T",
                "G",
                "A",
                "C",
                "C",
                "A",
                "G",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "delTC",
                "C",
                "T",
                "C",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "G",
                "G",
                "A",
                "delTT",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "T",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "A",
                "G",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "38433867:T;38440747:CGAT;38440796:A;38440802:T;38440818:G;38440829:C;38440830:G;38440851:C;38442361:G;38442373:T;38442395:C;38442434:C;38443790:G;38444179:C;38444187:C;38444191:G;38444203:A;38444211:C;38444212:G;38444217:G;38444220:G;38444221:A;38444250:G;38444252:G;38444253:C;38444257:A;38444671:G;38446481:C;38446492:G;38446517:T;38446520:A;38446710:G;38448500:C;38448501:G;38448673:C;38448680:T;38448712:G;38448715:G;38448791:G;38451785:C;38451842:C;38451843:G;38451850:C;38452985:C;38452996:G;38455247:A;38455253:C;38455254:T;38455269:G;38455347:T;38455359:A;38455463:G;38455471:C;38455472:G;38455489:T;38455504:G;38455528:C;38457539:G;38457545:C;38457546:G;38458175:G;38458247:G;38460461:C;38460551:C;38463499:G;38464649:G;38466144:G;38466216:G;38466315:G;38466347:C;38466386:G;38466392:G;38467655:G;38469002:C;38469111:C;38469404:A;38469415:G;38473635:A;38475335:A;38477816:A;38483293:A;38483329:C;38483345:C;38483357:C;38485679:T;38485688:A;38485691:G;38485787:A;38485838:C;38485841:T;38485972:C;38485996:T;38486015:C;38486095:A;38486096:T;38490151:C;38490642:A;38492540:G;38494379:T;38494381:G;38494426:G;38494454:G;38494464:C;38494465:G;38494555:G;38494564:C;38494565:G;38494579:G;38494621:A;38494625:G;38496265:C;38496278:C;38496283:C;38496294:G;38496301:T;38496306:G;38496415:C;38496416:G;38496455:G;38496487:C;38496488:G;38496502:C;38496901:G;38496910:A;38499177:A;38499223:G;38499234:T;38499241:A;38499639:G;38499642:C;38499643:G;38499644:TGGA;38499650:A;38499655:G;38499667:G;38499670:C;38499680:T;38499682:C;38499683:G;38499691:G;38499692:A;38499696:C;38499697:T;38499704:C;38499706:G;38499719:A;38499730:G;38499731:G;38499806:A;38499817:G;38499975:G;38499984:G;38499985:A;38499993:G;38499997:G;38500000:G;38500003:C;38500010:G;38500636:C;38500637:G;38500640:T;38500642:C;38500643:G;38500654:C;38500655:G;38500667:C;38500863:C;38500898:C;38500899:G;38500904:T;38502652:A;38502663:C;38502669:C;38502670:G;38502679:C;38502708:T;38502923:G;38504298:G;38504319:C;38504347:C;38504868:G;38504869:A;38504878:G;38505061:G;38505325:C;38505358:C;38505923:C;38505932:T;38506361:T;38506492:G;38506508:C;38506865:C;38507821:C;38511590:G;38512279:G;38512321:G;38512367:G;38515052:C;38516167:A;38516181:T;38516184:G;38516208:G;38517431:T;38517470:T;38517521:G;38517523:T;38517541:G;38519237:C;38519238:G;38519292:G;38519295:A;38519424:C;38519432:A;38519447:A;38525432:C;38525492:G;38527707:G;38527710:G;38528372:G;38529002:G;38529036:G;38529042:C;38529048:C;38534726:C;38534774:C;38534775:G;38535197:G;38535998:G;38543365:G;38543380:A;38543405:T;38543551:A;38543566:G;38543810:C;38543816:T;38543821:C;38543832:G;38546460:G;38546496:A;38548253:A;38548259:C;38548287:C;38548380:C;38561140:G;38561185:A;38561213:C;38561228:A;38561236:C;38561243:T;38561362:G;38561363:G;38561383:G;38565023:T;38565034:G;38565182:A;38565215:C;38565218:C;38566978:A;38566986:G;38570619:C;38570620:G;38570649:C;38572032:C;38572185:G;38572190:A;38572206:G;38572262:T;38572266:TC;38573180:C;38573229:T;38573304:C;38575957:G;38577931:A;38577942:T;38577946:G;38577954:C;38577955:G;38578015:G;38578205:G;38580004:A;38580039:TT;38580041:C;38580066:A;38580075:G;38580088:T;38580094:C;38580114:C;38580126:C;38580370:C;38580382:G;38580397:G;38580403:G;38580416:C;38580425:C;38580439:C;38580440:G;38580485:A;38580497:T;38584974:G;38584976:G;38584989:T;38585078:A;38585099:G;38585947:T;38585948:C;38585951:C;38585952:G;38585959:G;38586101:T;38586140:C;38586190:A;38587362:G;38587363:G;"
            ]
          },
          "haplotype2": {
            "name": "Reference",
            "haplotype": {
              "name": "Reference",
              "id": "PA166180377",
              "alleles": [
                "T",
                "CGAT",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "A",
                "G",
                "C",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "C",
                "T",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "A",
                "G",
                "A",
                "A",
                "A",
                "A",
                "C",
                "C",
                "C",
                "T",
                "A",
                "G",
                "A",
                "C",
                "T",
                "C",
                "T",
                "C",
                "A",
                "T",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "TGGA",
                "A",
                "G",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "A",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "T",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "C",
                "A",
                "T",
                "G",
                "G",
                "T",
                "T",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "C",
                "A",
                "A",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "A",
                "T",
                "A",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "G",
                "A",
                "C",
                "A",
                "C",
                "T",
                "G",
                "G",
                "G",
                "T",
                "G",
                "A",
                "C",
                "C",
                "A",
                "G",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "TC",
                "C",
                "T",
                "C",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "G",
                "G",
                "A",
                "TT",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "T",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "A",
                "G",
                "G"
              ],
              "cpicAlleles": [
                "T",
                "TGA",
                "A",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "C",
                "A",
                "G",
                "C",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "C",
                "del",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "C",
                "T",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "A",
                "G",
                "A",
                "A",
                "A",
                "A",
                "C",
                "C",
                "C",
                "T",
                "A",
                "G",
                "A",
                "C",
                "T",
                "C",
                "T",
                "C",
                "A",
                "T",
                "C",
                "A",
                "G",
                "T",
                "G",
                "G",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "G",
                "A",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "T",
                "A",
                "G",
                "C",
                "G",
                "GAG",
                "A",
                "G",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "C",
                "T",
                "C",
                "G",
                "A",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "A",
                "G",
                "G",
                "G",
                "C",
                "G",
                "C",
                "G",
                "T",
                "C",
                "G",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "A",
                "C",
                "C",
                "G",
                "C",
                "T",
                "G",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "G",
                "C",
                "C",
                "C",
                "T",
                "T",
                "G",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "C",
                "A",
                "T",
                "G",
                "G",
                "T",
                "T",
                "G",
                "T",
                "G",
                "C",
                "G",
                "G",
                "A",
                "C",
                "A",
                "A",
                "C",
                "G",
                "G",
                "G",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "G",
                "A",
                "T",
                "A",
                "G",
                "C",
                "T",
                "C",
                "G",
                "G",
                "A",
                "A",
                "C",
                "C",
                "C",
                "G",
                "A",
                "C",
                "A",
                "C",
                "T",
                "G",
                "G",
                "G",
                "T",
                "G",
                "A",
                "C",
                "C",
                "A",
                "G",
                "C",
                "G",
                "C",
                "C",
                "G",
                "A",
                "G",
                "T",
                "delTC",
                "C",
                "T",
                "C",
                "G",
                "A",
                "T",
                "G",
                "C",
                "G",
                "G",
                "G",
                "A",
                "delTT",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "C",
                "C",
                "G",
                "G",
                "G",
                "C",
                "C",
                "C",
                "G",
                "A",
                "T",
                "G",
                "G",
                "T",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "G",
                "T",
                "C",
                "A",
                "G",
                "G"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "38433867:T;38440747:CGAT;38440796:A;38440802:T;38440818:G;38440829:C;38440830:G;38440851:C;38442361:G;38442373:T;38442395:C;38442434:C;38443790:G;38444179:C;38444187:C;38444191:G;38444203:A;38444211:C;38444212:G;38444217:G;38444220:G;38444221:A;38444250:G;38444252:G;38444253:C;38444257:A;38444671:G;38446481:C;38446492:G;38446517:T;38446520:A;38446710:G;38448500:C;38448501:G;38448673:C;38448680:T;38448712:G;38448715:G;38448791:G;38451785:C;38451842:C;38451843:G;38451850:C;38452985:C;38452996:G;38455247:A;38455253:C;38455254:T;38455269:G;38455347:T;38455359:A;38455463:G;38455471:C;38455472:G;38455489:T;38455504:G;38455528:C;38457539:G;38457545:C;38457546:G;38458175:G;38458247:G;38460461:C;38460551:C;38463499:G;38464649:G;38466144:G;38466216:G;38466315:G;38466347:C;38466386:G;38466392:G;38467655:G;38469002:C;38469111:C;38469404:A;38469415:G;38473635:A;38475335:A;38477816:A;38483293:A;38483329:C;38483345:C;38483357:C;38485679:T;38485688:A;38485691:G;38485787:A;38485838:C;38485841:T;38485972:C;38485996:T;38486015:C;38486095:A;38486096:T;38490151:C;38490642:A;38492540:G;38494379:T;38494381:G;38494426:G;38494454:G;38494464:C;38494465:G;38494555:G;38494564:C;38494565:G;38494579:G;38494621:A;38494625:G;38496265:C;38496278:C;38496283:C;38496294:G;38496301:T;38496306:G;38496415:C;38496416:G;38496455:G;38496487:C;38496488:G;38496502:C;38496901:G;38496910:A;38499177:A;38499223:G;38499234:T;38499241:A;38499639:G;38499642:C;38499643:G;38499644:TGGA;38499650:A;38499655:G;38499667:G;38499670:C;38499680:T;38499682:C;38499683:G;38499691:G;38499692:A;38499696:C;38499697:T;38499704:C;38499706:G;38499719:A;38499730:G;38499731:G;38499806:A;38499817:G;38499975:G;38499984:G;38499985:A;38499993:G;38499997:G;38500000:G;38500003:C;38500010:G;38500636:C;38500637:G;38500640:T;38500642:C;38500643:G;38500654:C;38500655:G;38500667:C;38500863:C;38500898:C;38500899:G;38500904:T;38502652:A;38502663:C;38502669:C;38502670:G;38502679:C;38502708:T;38502923:G;38504298:G;38504319:C;38504347:C;38504868:G;38504869:A;38504878:G;38505061:G;38505325:C;38505358:C;38505923:C;38505932:T;38506361:T;38506492:G;38506508:C;38506865:C;38507821:C;38511590:G;38512279:G;38512321:G;38512367:G;38515052:C;38516167:A;38516181:T;38516184:G;38516208:G;38517431:T;38517470:T;38517521:G;38517523:T;38517541:G;38519237:C;38519238:G;38519292:G;38519295:A;38519424:C;38519432:A;38519447:A;38525432:C;38525492:G;38527707:G;38527710:G;38528372:G;38529002:G;38529036:G;38529042:C;38529048:C;38534726:C;38534774:C;38534775:G;38535197:G;38535998:G;38543365:G;38543380:A;38543405:T;38543551:A;38543566:G;38543810:C;38543816:T;38543821:C;38543832:G;38546460:G;38546496:A;38548253:A;38548259:C;38548287:C;38548380:C;38561140:G;38561185:A;38561213:C;38561228:A;38561236:C;38561243:T;38561362:G;38561363:G;38561383:G;38565023:T;38565034:G;38565182:A;38565215:C;38565218:C;38566978:A;38566986:G;38570619:C;38570620:G;38570649:C;38572032:C;38572185:G;38572190:A;38572206:G;38572262:T;38572266:TC;38573180:C;38573229:T;38573304:C;38575957:G;38577931:A;38577942:T;38577946:G;38577954:C;38577955:G;38578015:G;38578205:G;38580004:A;38580039:TT;38580041:C;38580066:A;38580075:G;38580088:T;38580094:C;38580114:C;38580126:C;38580370:C;38580382:G;38580397:G;38580403:G;38580416:C;38580425:C;38580439:C;38580440:G;38580485:A;38580497:T;38584974:G;38584976:G;38584989:T;38585078:A;38585099:G;38585947:T;38585948:C;38585951:C;38585952:G;38585959:G;38586101:T;38586140:C;38586190:A;38587362:G;38587363:G;"
            ]
          },
          "score": 626
        }
      ],
      "haplotypes": [
        {
          "name": "Reference",
          "haplotype": {
            "name": "Reference",
            "id": "PA166180377",
            "alleles": [
              "T",
              "CGAT",
              "A",
              "T",
              "G",
              "C",
              "G",
              "C",
              "G",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "C",
              "G",
              "G",
              "G",
              "A",
              "G",
              "G",
              "C",
              "A",
              "G",
              "C",
              "G",
              "T",
              "A",
              "G",
              "C",
              "G",
              "C",
              "T",
              "G",
              "G",
              "G",
              "C",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "C",
              "T",
              "G",
              "T",
              "A",
              "G",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "C",
              "G",
              "G",
              "G",
              "C",
              "C",
              "G",
              "G",
              "G",
              "G",
              "G",
              "C",
              "G",
              "G",
              "G",
              "C",
              "C",
              "A",
              "G",
              "A",
              "A",
              "A",
              "A",
              "C",
              "C",
              "C",
              "T",
              "A",
              "G",
              "A",
              "C",
              "T",
              "C",
              "T",
              "C",
              "A",
              "T",
              "C",
              "A",
              "G",
              "T",
              "G",
              "G",
              "G",
              "C",
              "G",
              "G",
              "C",
              "G",
              "G",
              "A",
              "G",
              "C",
              "C",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "G",
              "C",
              "G",
              "C",
              "G",
              "A",
              "A",
              "G",
              "T",
              "A",
              "G",
              "C",
              "G",
              "TGGA",
              "A",
              "G",
              "G",
              "C",
              "T",
              "C",
              "G",
              "G",
              "A",
              "C",
              "T",
              "C",
              "G",
              "A",
              "G",
              "G",
              "A",
              "G",
              "G",
              "G",
              "A",
              "G",
              "G",
              "G",
              "C",
              "G",
              "C",
              "G",
              "T",
              "C",
              "G",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "T",
              "A",
              "C",
              "C",
              "G",
              "C",
              "T",
              "G",
              "G",
              "C",
              "C",
              "G",
              "A",
              "G",
              "G",
              "C",
              "C",
              "C",
              "T",
              "T",
              "G",
              "C",
              "C",
              "C",
              "G",
              "G",
              "G",
              "G",
              "C",
              "A",
              "T",
              "G",
              "G",
              "T",
              "T",
              "G",
              "T",
              "G",
              "C",
              "G",
              "G",
              "A",
              "C",
              "A",
              "A",
              "C",
              "G",
              "G",
              "G",
              "G",
              "G",
              "G",
              "C",
              "C",
              "C",
              "C",
              "G",
              "G",
              "G",
              "G",
              "A",
              "T",
              "A",
              "G",
              "C",
              "T",
              "C",
              "G",
              "G",
              "A",
              "A",
              "C",
              "C",
              "C",
              "G",
              "A",
              "C",
              "A",
              "C",
              "T",
              "G",
              "G",
              "G",
              "T",
              "G",
              "A",
              "C",
              "C",
              "A",
              "G",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "G",
              "T",
              "TC",
              "C",
              "T",
              "C",
              "G",
              "A",
              "T",
              "G",
              "C",
              "G",
              "G",
              "G",
              "A",
              "TT",
              "C",
              "A",
              "G",
              "T",
              "C",
              "C",
              "C",
              "C",
              "G",
              "G",
              "G",
              "C",
              "C",
              "C",
              "G",
              "A",
              "T",
              "G",
              "G",
              "T",
              "A",
              "G",
              "T",
              "C",
              "C",
              "G",
              "G",
              "T",
              "C",
              "A",
              "G",
              "G"
            ],
            "cpicAlleles": [
              "T",
              "TGA",
              "A",
              "T",
              "G",
              "C",
              "G",
              "C",
              "G",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "C",
              "G",
              "G",
              "G",
              "A",
              "G",
              "G",
              "C",
              "A",
              "G",
              "C",
              "G",
              "T",
              "A",
              "G",
              "C",
              "G",
              "C",
              "del",
              "G",
              "G",
              "G",
              "C",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "C",
              "T",
              "G",
              "T",
              "A",
              "G",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "C",
              "G",
              "G",
              "G",
              "C",
              "C",
              "G",
              "G",
              "G",
              "G",
              "G",
              "C",
              "G",
              "G",
              "G",
              "C",
              "C",
              "A",
              "G",
              "A",
              "A",
              "A",
              "A",
              "C",
              "C",
              "C",
              "T",
              "A",
              "G",
              "A",
              "C",
              "T",
              "C",
              "T",
              "C",
              "A",
              "T",
              "C",
              "A",
              "G",
              "T",
              "G",
              "G",
              "G",
              "C",
              "G",
              "G",
              "C",
              "G",
              "G",
              "A",
              "G",
              "C",
              "C",
              "C",
              "G",
              "T",
              "G",
              "C",
              "G",
              "G",
              "C",
              "G",
              "C",
              "G",
              "A",
              "A",
              "G",
              "T",
              "A",
              "G",
              "C",
              "G",
              "GAG",
              "A",
              "G",
              "G",
              "C",
              "T",
              "C",
              "G",
              "G",
              "A",
              "C",
              "T",
              "C",
              "G",
              "A",
              "G",
              "G",
              "A",
              "G",
              "G",
              "G",
              "A",
              "G",
              "G",
              "G",
              "C",
              "G",
              "C",
              "G",
              "T",
              "C",
              "G",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "T",
              "A",
              "C",
              "C",
              "G",
              "C",
              "T",
              "G",
              "G",
              "C",
              "C",
              "G",
              "A",
              "G",
              "G",
              "C",
              "C",
              "C",
              "T",
              "T",
              "G",
              "C",
              "C",
              "C",
              "G",
              "G",
              "G",
              "G",
              "C",
              "A",
              "T",
              "G",
              "G",
              "T",
              "T",
              "G",
              "T",
              "G",
              "C",
              "G",
              "G",
              "A",
              "C",
              "A",
              "A",
              "C",
              "G",
              "G",
              "G",
              "G",
              "G",
              "G",
              "C",
              "C",
              "C",
              "C",
              "G",
              "G",
              "G",
              "G",
              "A",
              "T",
              "A",
              "G",
              "C",
              "T",
              "C",
              "G",
              "G",
              "A",
              "A",
              "C",
              "C",
              "C",
              "G",
              "A",
              "C",
              "A",
              "C",
              "T",
              "G",
              "G",
              "G",
              "T",
              "G",
              "A",
              "C",
              "C",
              "A",
              "G",
              "C",
              "G",
              "C",
              "C",
              "G",
              "A",
              "G",
              "T",
              "delTC",
              "C",
              "T",
              "C",
              "G",
              "A",
              "T",
              "G",
              "C",
              "G",
              "G",
              "G",
              "A",
              "delTT",
              "C",
              "A",
              "G",
              "T",
              "C",
              "C",
              "C",
              "C",
              "G",
              "G",
              "G",
              "C",
              "C",
              "C",
              "G",
              "A",
              "T",
              "G",
              "G",
              "T",
              "A",
              "G",
              "T",
              "C",
              "C",
              "G",
              "G",
              "T",
              "C",
              "A",
              "G",
              "G"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "38433867:T;38440747:CGAT;38440796:A;38440802:T;38440818:G;38440829:C;38440830:G;38440851:C;38442361:G;38442373:T;38442395:C;38442434:C;38443790:G;38444179:C;38444187:C;38444191:G;38444203:A;38444211:C;38444212:G;38444217:G;38444220:G;38444221:A;38444250:G;38444252:G;38444253:C;38444257:A;38444671:G;38446481:C;38446492:G;38446517:T;38446520:A;38446710:G;38448500:C;38448501:G;38448673:C;38448680:T;38448712:G;38448715:G;38448791:G;38451785:C;38451842:C;38451843:G;38451850:C;38452985:C;38452996:G;38455247:A;38455253:C;38455254:T;38455269:G;38455347:T;38455359:A;38455463:G;38455471:C;38455472:G;38455489:T;38455504:G;38455528:C;38457539:G;38457545:C;38457546:G;38458175:G;38458247:G;38460461:C;38460551:C;38463499:G;38464649:G;38466144:G;38466216:G;38466315:G;38466347:C;38466386:G;38466392:G;38467655:G;38469002:C;38469111:C;38469404:A;38469415:G;38473635:A;38475335:A;38477816:A;38483293:A;38483329:C;38483345:C;38483357:C;38485679:T;38485688:A;38485691:G;38485787:A;38485838:C;38485841:T;38485972:C;38485996:T;38486015:C;38486095:A;38486096:T;38490151:C;38490642:A;38492540:G;38494379:T;38494381:G;38494426:G;38494454:G;38494464:C;38494465:G;38494555:G;38494564:C;38494565:G;38494579:G;38494621:A;38494625:G;38496265:C;38496278:C;38496283:C;38496294:G;38496301:T;38496306:G;38496415:C;38496416:G;38496455:G;38496487:C;38496488:G;38496502:C;38496901:G;38496910:A;38499177:A;38499223:G;38499234:T;38499241:A;38499639:G;38499642:C;38499643:G;38499644:TGGA;38499650:A;38499655:G;38499667:G;38499670:C;38499680:T;38499682:C;38499683:G;38499691:G;38499692:A;38499696:C;38499697:T;38499704:C;38499706:G;38499719:A;38499730:G;38499731:G;38499806:A;38499817:G;38499975:G;38499984:G;38499985:A;38499993:G;38499997:G;38500000:G;38500003:C;38500010:G;38500636:C;38500637:G;38500640:T;38500642:C;38500643:G;38500654:C;38500655:G;38500667:C;38500863:C;38500898:C;38500899:G;38500904:T;38502652:A;38502663:C;38502669:C;38502670:G;38502679:C;38502708:T;38502923:G;38504298:G;38504319:C;38504347:C;38504868:G;38504869:A;38504878:G;38505061:G;38505325:C;38505358:C;38505923:C;38505932:T;38506361:T;38506492:G;38506508:C;38506865:C;38507821:C;38511590:G;38512279:G;38512321:G;38512367:G;38515052:C;38516167:A;38516181:T;38516184:G;38516208:G;38517431:T;38517470:T;38517521:G;38517523:T;38517541:G;38519237:C;38519238:G;38519292:G;38519295:A;38519424:C;38519432:A;38519447:A;38525432:C;38525492:G;38527707:G;38527710:G;38528372:G;38529002:G;38529036:G;38529042:C;38529048:C;38534726:C;38534774:C;38534775:G;38535197:G;38535998:G;38543365:G;38543380:A;38543405:T;38543551:A;38543566:G;38543810:C;38543816:T;38543821:C;38543832:G;38546460:G;38546496:A;38548253:A;38548259:C;38548287:C;38548380:C;38561140:G;38561185:A;38561213:C;38561228:A;38561236:C;38561243:T;38561362:G;38561363:G;38561383:G;38565023:T;38565034:G;38565182:A;38565215:C;38565218:C;38566978:A;38566986:G;38570619:C;38570620:G;38570649:C;38572032:C;38572185:G;38572190:A;38572206:G;38572262:T;38572266:TC;38573180:C;38573229:T;38573304:C;38575957:G;38577931:A;38577942:T;38577946:G;38577954:C;38577955:G;38578015:G;38578205:G;38580004:A;38580039:TT;38580041:C;38580066:A;38580075:G;38580088:T;38580094:C;38580114:C;38580126:C;38580370:C;38580382:G;38580397:G;38580403:G;38580416:C;38580425:C;38580439:C;38580440:G;38580485:A;38580497:T;38584974:G;38584976:G;38584989:T;38585078:A;38585099:G;38585947:T;38585948:C;38585951:C;38585952:G;38585959:G;38586101:T;38586140:C;38586190:A;38587362:G;38587363:G;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 38433867,
          "rsid": "rs193922744",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38440747,
          "rsid": "rs193922745",
          "vcfCall": "CGAT|CGAT",
          "phased": true
        },
        {
          "position": 38440796,
          "rsid": "rs193922746",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38440802,
          "rsid": "rs193922747",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38440818,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38440829,
          "rsid": "rs193922748",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38440830,
          "rsid": "rs139161723",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38440851,
          "rsid": "rs193922749",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38442361,
          "rsid": "rs118192160",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38442373,
          "rsid": "rs995399438",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38442395,
          "rsid": "rs118192113",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38442434,
          "rsid": "rs186983396",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38443790,
          "rsid": "rs142474192",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444179,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38444187,
          "rsid": "rs193922750",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38444191,
          "rsid": "rs193922751",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444203,
          "rsid": "rs193922752",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38444211,
          "rsid": "rs118192161",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38444212,
          "rsid": "rs193922753",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444217,
          "rsid": "rs193922754",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444220,
          "rsid": "rs193922755",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444221,
          "rsid": "rs193922756",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38444250,
          "rsid": "rs761616815",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444252,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38444253,
          "rsid": "rs193922757",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38444257,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38444671,
          "rsid": "rs771058055",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38446481,
          "rsid": "rs727504129",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38446492,
          "rsid": "rs193922759",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38446517,
          "rsid": "rs112596687",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38446520,
          "rsid": "rs193922760",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38446710,
          "rsid": "rs1801086",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38448500,
          "rsid": "rs752652072",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38448501,
          "rsid": "rs193922761",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38448673,
          "rsid": "rs193922762",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38448680,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38448712,
          "rsid": "rs121918592",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38448715,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38448791,
          "rsid": "rs113332073",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38451785,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38451842,
          "rsid": "rs193922764",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38451843,
          "rsid": "rs193922766",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38451850,
          "rsid": "rs118192116",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38452985,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38452996,
          "rsid": "rs193922767",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38455247,
          "rsid": "rs147723844",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38455253,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38455254,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38455269,
          "rsid": "rs901087791",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38455347,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38455359,
          "rsid": "rs118192162",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38455463,
          "rsid": "rs111888148",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38455471,
          "rsid": "rs193922768",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38455472,
          "rsid": "rs144336148",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38455489,
          "rsid": "rs193922769",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38455504,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38455528,
          "rsid": "rs193922770",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38457539,
          "rsid": "rs118204423",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38457545,
          "rsid": "rs118192172",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38457546,
          "rsid": "rs193922772",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38458175,
          "rsid": "rs747177274",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38458247,
          "rsid": "rs138874610",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38460461,
          "rsid": "rs376149732",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38460551,
          "rsid": "rs193922775",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38463499,
          "rsid": "rs370634440",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38464649,
          "rsid": "rs148623597",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38466144,
          "rsid": "rs778241277",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38466216,
          "rsid": "rs180714609",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38466315,
          "rsid": "rs141942845",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38466347,
          "rsid": "rs111272095",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38466386,
          "rsid": "rs2145447772",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38466392,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38467655,
          "rsid": "rs749040743",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38469002,
          "rsid": "rs193922776",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38469111,
          "rsid": "rs549201486",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38469404,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38469415,
          "rsid": "rs936513262",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38473635,
          "rsid": "rs34694816",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38475335,
          "rsid": "rs137933390",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38477816,
          "rsid": "rs145573319",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38483293,
          "rsid": "rs146429605",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38483329,
          "rsid": "rs754476250",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38483345,
          "rsid": "rs151029675",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38483357,
          "rsid": "rs193922777",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38485679,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38485688,
          "rsid": "rs781104539",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38485691,
          "rsid": "rs146504767",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38485787,
          "rsid": "rs754785770",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38485838,
          "rsid": "rs193922781",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38485841,
          "rsid": "rs193922782",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38485972,
          "rsid": "rs192863857",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38485996,
          "rsid": "rs372958050",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38486015,
          "rsid": "rs34934920",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38486095,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38486096,
          "rsid": "rs193922783",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38490151,
          "rsid": "rs145801146",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38490642,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38492540,
          "rsid": "rs35364374",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494379,
          "rsid": "rs746818096",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38494381,
          "rsid": "rs770593660",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494426,
          "rsid": "rs193922788",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494454,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494464,
          "rsid": "rs117886618",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38494465,
          "rsid": "rs193922789",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494555,
          "rsid": "rs143398211",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494564,
          "rsid": "rs118192175",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38494565,
          "rsid": "rs118192163",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494579,
          "rsid": "rs118192176",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38494621,
          "rsid": "rs193922790",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38494625,
          "rsid": "rs959170123",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496265,
          "rsid": "rs193922791",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38496278,
          "rsid": "rs141646642",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38496283,
          "rsid": "rs118192177",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38496294,
          "rsid": "rs193922792",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496301,
          "rsid": "rs193922793",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38496306,
          "rsid": "rs193922795",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496415,
          "rsid": "rs199870223",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38496416,
          "rsid": "rs537994744",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496455,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496487,
          "rsid": "rs763352221",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38496488,
          "rsid": "rs140152019",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496502,
          "rsid": "rs917523269",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38496901,
          "rsid": "rs193922797",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38496910,
          "rsid": "rs118192121",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499177,
          "rsid": "rs34390345",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499223,
          "rsid": "rs112563513",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499234,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38499241,
          "rsid": "rs147213895",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499639,
          "rsid": "rs193922798",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499642,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38499643,
          "rsid": "rs193922799",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499644,
          "rsid": "rs121918596",
          "vcfCall": "TGGA|TGGA",
          "phased": true
        },
        {
          "position": 38499650,
          "rsid": "rs193922801",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499655,
          "rsid": "rs193922802",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499667,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499670,
          "rsid": "rs193922803",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38499680,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38499682,
          "rsid": "rs769482889",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38499683,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499691,
          "rsid": "rs762401851",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499692,
          "rsid": "rs193922804",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499696,
          "rsid": null,
          "vcfCall": "C|T",
          "phased": true
        },
        {
          "position": 38499697,
          "rsid": "rs193922805",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38499704,
          "rsid": "rs193922806",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38499706,
          "rsid": "rs146306934",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499719,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499730,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499731,
          "rsid": "rs193922807",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499806,
          "rsid": "rs976108591",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499817,
          "rsid": "rs111364296",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499975,
          "rsid": "rs193922809",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499984,
          "rsid": "rs193922810",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499985,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38499993,
          "rsid": "rs121918593",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38499997,
          "rsid": "rs28933396",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500000,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500003,
          "rsid": "rs193922812",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500010,
          "rsid": "rs193922813",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500636,
          "rsid": "rs118192124",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500637,
          "rsid": "rs193922815",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500640,
          "rsid": "rs118192123",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38500642,
          "rsid": "rs193922816",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500643,
          "rsid": "rs118192122",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500654,
          "rsid": "rs28933397",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500655,
          "rsid": "rs121918594",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500667,
          "rsid": "rs551223467",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500863,
          "rsid": "rs193922817",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500898,
          "rsid": "rs118192178",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38500899,
          "rsid": "rs193922818",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38500904,
          "rsid": "rs193922819",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38502652,
          "rsid": "rs767553612",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38502663,
          "rsid": "rs193922822",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38502669,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38502670,
          "rsid": "rs751180702",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38502679,
          "rsid": "rs193922824",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38502708,
          "rsid": "rs748575133",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38502923,
          "rsid": "rs914804033",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38504298,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38504319,
          "rsid": "rs193922826",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38504347,
          "rsid": "rs781126470",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38504868,
          "rsid": "rs193922827",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38504869,
          "rsid": "rs112196644",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38504878,
          "rsid": "rs193922828",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38505061,
          "rsid": "rs193922829",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38505325,
          "rsid": "rs147707463",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38505358,
          "rsid": "rs35180584",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38505923,
          "rsid": "rs193922830",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38505932,
          "rsid": "rs768535909",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38506361,
          "rsid": "rs193922831",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38506492,
          "rsid": "rs112772310",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38506508,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38506865,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38507821,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38511590,
          "rsid": "rs147303895",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38512279,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38512321,
          "rsid": "rs193922832",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38512367,
          "rsid": "rs193922833",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38515052,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38516167,
          "rsid": "rs199738299",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38516181,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38516184,
          "rsid": "rs553055844",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38516208,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38517431,
          "rsid": "rs375626634",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38517470,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38517521,
          "rsid": "rs757753317",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38517523,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38517541,
          "rsid": "rs112151058",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38519237,
          "rsid": "rs118204421",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38519238,
          "rsid": "rs193922834",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38519292,
          "rsid": "rs137932199",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38519295,
          "rsid": "rs118192126",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38519424,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38519432,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38519447,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38525432,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38525492,
          "rsid": "rs143987857",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38527707,
          "rsid": "rs55876273",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38527710,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38528372,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38529002,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38529036,
          "rsid": "rs193922838",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38529042,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38529048,
          "rsid": "rs375915752",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38534726,
          "rsid": "rs4802584",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38534774,
          "rsid": "rs763112609",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38534775,
          "rsid": "rs193922839",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38535197,
          "rsid": "rs111565359",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38535998,
          "rsid": "rs140616359",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38543365,
          "rsid": "rs148399313",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38543380,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38543405,
          "rsid": "rs193922840",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38543551,
          "rsid": "rs147136339",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38543566,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38543810,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38543816,
          "rsid": "rs118204422",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38543821,
          "rsid": "rs193922842",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38543832,
          "rsid": "rs193922843",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38546460,
          "rsid": "rs755088027",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38546496,
          "rsid": "rs773040531",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38548253,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38548259,
          "rsid": "rs144685735",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38548287,
          "rsid": "rs193922844",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38548380,
          "rsid": "rs373406011",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38561140,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38561185,
          "rsid": "rs193922848",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38561213,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38561228,
          "rsid": "rs201321695",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38561236,
          "rsid": "rs193922849",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38561243,
          "rsid": "rs193922850",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38561362,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38561363,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38561383,
          "rsid": "rs151119428",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38565023,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38565034,
          "rsid": "rs193922852",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38565182,
          "rsid": "rs193922853",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38565215,
          "rsid": "rs587784372",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38565218,
          "rsid": "rs193922855",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38566978,
          "rsid": "rs139647387",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38566986,
          "rsid": "rs150396398",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38570619,
          "rsid": "rs771741606",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38570620,
          "rsid": "rs118192130",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38570649,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38572032,
          "rsid": "rs143520367",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38572185,
          "rsid": "rs118192135",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38572190,
          "rsid": "rs756850145",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38572206,
          "rsid": "rs193922860",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38572262,
          "rsid": "rs759500310",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38572266,
          "rsid": "rs193922862",
          "vcfCall": "TC|TC",
          "phased": true
        },
        {
          "position": 38573180,
          "rsid": "rs193922863",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38573229,
          "rsid": "rs193922864",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38573304,
          "rsid": "rs118192140",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38575957,
          "rsid": "rs200766617",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38577931,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38577942,
          "rsid": "rs193922865",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38577946,
          "rsid": "rs193922866",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38577954,
          "rsid": "rs193922867",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38577955,
          "rsid": "rs193922868",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38578015,
          "rsid": "rs768360593",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38578205,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38580004,
          "rsid": "rs118192167",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38580039,
          "rsid": null,
          "vcfCall": "TT|TT",
          "phased": true
        },
        {
          "position": 38580041,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580066,
          "rsid": "rs143988412",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38580075,
          "rsid": "rs193922873",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38580088,
          "rsid": "rs193922874",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38580094,
          "rsid": "rs121918595",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580114,
          "rsid": "rs193922876",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580126,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580370,
          "rsid": "rs193922878",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580382,
          "rsid": "rs193922879",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38580397,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38580403,
          "rsid": "rs118192168",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38580416,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580425,
          "rsid": "rs193922880",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580439,
          "rsid": "rs118192181",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38580440,
          "rsid": "rs63749869",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38580485,
          "rsid": "rs113210953",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38580497,
          "rsid": "rs193922883",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38584974,
          "rsid": "rs118192151",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38584976,
          "rsid": "rs193922888",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38584989,
          "rsid": "rs118192170",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38585078,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38585099,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38585947,
          "rsid": "rs111657878",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38585948,
          "rsid": "rs118192159",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38585951,
          "rsid": "rs193922895",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38585952,
          "rsid": "rs118192158",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38585959,
          "rsid": "rs193922896",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38586101,
          "rsid": "rs193922898",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 38586140,
          "rsid": "rs146876145",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 38586190,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 38587362,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 38587363,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [
          {
            "chromosome": "chr19",
            "position": 38499696,
            "cpicPosition": 38499696,
            "rsid": null,
            "chromosomeHgvsName": "g.38499696C>G",
            "cpicAlleles": [
              "C",
              "G"
            ],
            "cpicToVcfAlleleMap": {
              "C": "C",
              "G": "G"
            },
            "ref": "C",
            "alts": [
              "G"
            ]
          }
        ],
        "treatUndocumentedVariationsAsReference": true,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr12",
      "gene": "SLCO1B1",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165981641",
              "alleles": [
                "C",
                "G",
                "T",
                "T",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "A",
                "T",
                "A",
                "A",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "A",
                "G",
                "A",
                "G",
                "A",
                "C",
                "A",
                "A",
                "A",
                "C",
                "C"
              ],
              "cpicAlleles": [
                "C",
                "G",
                "T",
                "T",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "A",
                "T",
                "A",
                "A",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "A",
                "G",
                "A",
                "G",
                "A",
                "C",
                "A",
                "A",
                "A",
                "C",
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "21172734:C;21172776:G;21172782:T;21174595:T;21176804:A;21176868:A;21176871:G;21176879:C;21176883:A;21176898:G;21178612:A;21178615:T;21178957:A;21196951:A;21196975:C;21196976:G;21200544:C;21200595:T;21202553:T;21202555:C;21202649:A;21202664:G;21205921:A;21205999:G;21206031:A;21222355:C;21239042:A;21239077:A;21239113:A;21239145:C;21239158:C;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165981641",
              "alleles": [
                "C",
                "G",
                "T",
                "T",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "A",
                "T",
                "A",
                "A",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "A",
                "G",
                "A",
                "G",
                "A",
                "C",
                "A",
                "A",
                "A",
                "C",
                "C"
              ],
              "cpicAlleles": [
                "C",
                "G",
                "T",
                "T",
                "A",
                "A",
                "G",
                "C",
                "A",
                "G",
                "A",
                "T",
                "A",
                "A",
                "C",
                "G",
                "C",
                "T",
                "T",
                "C",
                "A",
                "G",
                "A",
                "G",
                "A",
                "C",
                "A",
                "A",
                "A",
                "C",
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "21172734:C;21172776:G;21172782:T;21174595:T;21176804:A;21176868:A;21176871:G;21176879:C;21176883:A;21176898:G;21178612:A;21178615:T;21178957:A;21196951:A;21196975:C;21196976:G;21200544:C;21200595:T;21202553:T;21202555:C;21202649:A;21202664:G;21205921:A;21205999:G;21206031:A;21222355:C;21239042:A;21239077:A;21239113:A;21239145:C;21239158:C;"
            ]
          },
          "score": 62
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA165981641",
            "alleles": [
              "C",
              "G",
              "T",
              "T",
              "A",
              "A",
              "G",
              "C",
              "A",
              "G",
              "A",
              "T",
              "A",
              "A",
              "C",
              "G",
              "C",
              "T",
              "T",
              "C",
              "A",
              "G",
              "A",
              "G",
              "A",
              "C",
              "A",
              "A",
              "A",
              "C",
              "C"
            ],
            "cpicAlleles": [
              "C",
              "G",
              "T",
              "T",
              "A",
              "A",
              "G",
              "C",
              "A",
              "G",
              "A",
              "T",
              "A",
              "A",
              "C",
              "G",
              "C",
              "T",
              "T",
              "C",
              "A",
              "G",
              "A",
              "G",
              "A",
              "C",
              "A",
              "A",
              "A",
              "C",
              "C"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "21172734:C;21172776:G;21172782:T;21174595:T;21176804:A;21176868:A;21176871:G;21176879:C;21176883:A;21176898:G;21178612:A;21178615:T;21178957:A;21196951:A;21196975:C;21196976:G;21200544:C;21200595:T;21202553:T;21202555:C;21202649:A;21202664:G;21205921:A;21205999:G;21206031:A;21222355:C;21239042:A;21239077:A;21239113:A;21239145:C;21239158:C;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 21172734,
          "rsid": "rs139257324",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21172776,
          "rsid": "rs373327528",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 21172782,
          "rsid": "rs56101265",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 21174595,
          "rsid": "rs56061388",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 21176804,
          "rsid": "rs2306283",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21176868,
          "rsid": "rs2306282",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21176871,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 21176879,
          "rsid": "rs11045819",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21176883,
          "rsid": "rs72559745",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21176898,
          "rsid": "rs77271279",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 21178612,
          "rsid": "rs141467543",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21178615,
          "rsid": "rs4149056",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 21178957,
          "rsid": "rs79135870",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21196951,
          "rsid": "rs11045852",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21196975,
          "rsid": "rs183501729",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21196976,
          "rsid": "rs11045853",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 21200544,
          "rsid": "rs72559747",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21200595,
          "rsid": "rs55901008",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 21202553,
          "rsid": "rs1228465562",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 21202555,
          "rsid": "rs59113707",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21202649,
          "rsid": "rs56387224",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21202664,
          "rsid": "rs142965323",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 21205921,
          "rsid": "rs72559748",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21205999,
          "rsid": "rs59502379",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 21206031,
          "rsid": "rs74064213",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21222355,
          "rsid": "rs71581941",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21239042,
          "rsid": "rs34671512",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21239077,
          "rsid": "rs56199088",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21239113,
          "rsid": "rs55737008",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 21239145,
          "rsid": "rs200995543",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 21239158,
          "rsid": "rs140790673",
          "vcfCall": "C|C",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr6",
      "gene": "TPMT",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165819268",
              "alleles": [
                "T",
                "T",
                "A",
                "C",
                "A",
                "C",
                "A",
                "C",
                "A",
                "A",
                "C",
                "T",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "T",
                "C",
                "C",
                "A",
                "C",
                "G",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "C",
                "C",
                "T",
                "A",
                "T"
              ],
              "cpicAlleles": [
                "T",
                "T",
                "A",
                "C",
                "A",
                "C",
                "A",
                "C",
                "A",
                "A",
                "C",
                "T",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "T",
                "C",
                "C",
                "A",
                "C",
                "G",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "C",
                "del",
                "T",
                "A",
                "T"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "18130687:T;18130694:T;18130725:A;18130729:C;18130758:A;18130762:C;18130772:A;18130781:C;18132136:A;18132147:A;18132163:C;18133845:T;18133847:C;18133870:A;18133884:G;18133887:T;18133890:C;18138969:C;18138970:G;18138997:C;18139027:C;18139689:C;18139710:G;18143597:T;18143606:T;18143613:C;18143622:C;18143643:A;18143700:C;18143718:G;18143724:C;18143728:C;18147838:G;18147845:C;18147851:G;18147856:A;18147910:A;18149004:G;18149022:C;18149032:C;18149045:T;18149126:A;18149127:T;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA165819268",
              "alleles": [
                "T",
                "T",
                "A",
                "C",
                "A",
                "C",
                "A",
                "C",
                "A",
                "A",
                "C",
                "T",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "T",
                "C",
                "C",
                "A",
                "C",
                "G",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "C",
                "C",
                "T",
                "A",
                "T"
              ],
              "cpicAlleles": [
                "T",
                "T",
                "A",
                "C",
                "A",
                "C",
                "A",
                "C",
                "A",
                "A",
                "C",
                "T",
                "C",
                "A",
                "G",
                "T",
                "C",
                "C",
                "G",
                "C",
                "C",
                "C",
                "G",
                "T",
                "T",
                "C",
                "C",
                "A",
                "C",
                "G",
                "C",
                "C",
                "G",
                "C",
                "G",
                "A",
                "A",
                "G",
                "C",
                "del",
                "T",
                "A",
                "T"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "18130687:T;18130694:T;18130725:A;18130729:C;18130758:A;18130762:C;18130772:A;18130781:C;18132136:A;18132147:A;18132163:C;18133845:T;18133847:C;18133870:A;18133884:G;18133887:T;18133890:C;18138969:C;18138970:G;18138997:C;18139027:C;18139689:C;18139710:G;18143597:T;18143606:T;18143613:C;18143622:C;18143643:A;18143700:C;18143718:G;18143724:C;18143728:C;18147838:G;18147845:C;18147851:G;18147856:A;18147910:A;18149004:G;18149022:C;18149032:C;18149045:T;18149126:A;18149127:T;"
            ]
          },
          "score": 86
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA165819268",
            "alleles": [
              "T",
              "T",
              "A",
              "C",
              "A",
              "C",
              "A",
              "C",
              "A",
              "A",
              "C",
              "T",
              "C",
              "A",
              "G",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "T",
              "T",
              "C",
              "C",
              "A",
              "C",
              "G",
              "C",
              "C",
              "G",
              "C",
              "G",
              "A",
              "A",
              "G",
              "C",
              "C",
              "T",
              "A",
              "T"
            ],
            "cpicAlleles": [
              "T",
              "T",
              "A",
              "C",
              "A",
              "C",
              "A",
              "C",
              "A",
              "A",
              "C",
              "T",
              "C",
              "A",
              "G",
              "T",
              "C",
              "C",
              "G",
              "C",
              "C",
              "C",
              "G",
              "T",
              "T",
              "C",
              "C",
              "A",
              "C",
              "G",
              "C",
              "C",
              "G",
              "C",
              "G",
              "A",
              "A",
              "G",
              "C",
              "del",
              "T",
              "A",
              "T"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "18130687:T;18130694:T;18130725:A;18130729:C;18130758:A;18130762:C;18130772:A;18130781:C;18132136:A;18132147:A;18132163:C;18133845:T;18133847:C;18133870:A;18133884:G;18133887:T;18133890:C;18138969:C;18138970:G;18138997:C;18139027:C;18139689:C;18139710:G;18143597:T;18143606:T;18143613:C;18143622:C;18143643:A;18143700:C;18143718:G;18143724:C;18143728:C;18147838:G;18147845:C;18147851:G;18147856:A;18147910:A;18149004:G;18149022:C;18149032:C;18149045:T;18149126:A;18149127:T;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 18130687,
          "rsid": "rs1142345",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18130694,
          "rsid": "rs150900439",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18130725,
          "rsid": "rs72552736",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18130729,
          "rsid": "rs139392616",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18130758,
          "rsid": "rs398122996",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18130762,
          "rsid": "rs56161402",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18130772,
          "rsid": "rs377085266",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18130781,
          "rsid": "rs1800584",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18132136,
          "rsid": "rs72556347",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18132147,
          "rsid": "rs79901429",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18132163,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18133845,
          "rsid": "rs75543815",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18133847,
          "rsid": "rs6921269",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18133870,
          "rsid": "rs772832951",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18133884,
          "rsid": "rs74423290",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18133887,
          "rsid": "rs201695576",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18133890,
          "rsid": "rs9333570",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18138969,
          "rsid": "rs144041067",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18138970,
          "rsid": "rs112339338",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18138997,
          "rsid": "rs1800460",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18139027,
          "rsid": "rs72552737",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18139689,
          "rsid": "rs72552738",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18139710,
          "rsid": "rs200220210",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18143597,
          "rsid": null,
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18143606,
          "rsid": "rs151149760",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18143613,
          "rsid": null,
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18143622,
          "rsid": "rs115106679",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18143643,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18143700,
          "rsid": "rs753545734",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18143718,
          "rsid": "rs111901354",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18143724,
          "rsid": "rs1800462",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18143728,
          "rsid": "rs1256618794",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18147838,
          "rsid": "rs281874771",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18147845,
          "rsid": "rs777686348",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18147851,
          "rsid": "rs200591577",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18147856,
          "rsid": null,
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18147910,
          "rsid": "rs72552740",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18149004,
          "rsid": null,
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 18149022,
          "rsid": "rs750424422",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18149032,
          "rsid": "rs759836180",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 18149045,
          "rsid": "rs72552742",
          "vcfCall": "T|T",
          "phased": true
        },
        {
          "position": 18149126,
          "rsid": "rs267607275",
          "vcfCall": "A|A",
          "phased": true
        },
        {
          "position": 18149127,
          "rsid": "rs9333569",
          "vcfCall": "T|T",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr2",
      "gene": "UGT1A1",
      "diplotypes": [
        {
          "name": "*1/*1",
          "haplotype1": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA166115841",
              "alleles": [
                "C",
                "CAT",
                "G",
                "C"
              ],
              "cpicAlleles": [
                "C",
                "TA(7)",
                "G",
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "233759924:C;233760233:CAT;233760498:G;233760973:C;"
            ]
          },
          "haplotype2": {
            "name": "*1",
            "haplotype": {
              "name": "*1",
              "id": "PA166115841",
              "alleles": [
                "C",
                "CAT",
                "G",
                "C"
              ],
              "cpicAlleles": [
                "C",
                "TA(7)",
                "G",
                "C"
              ],
              "reference": true,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "233759924:C;233760233:CAT;233760498:G;233760973:C;"
            ]
          },
          "score": 8
        }
      ],
      "haplotypes": [
        {
          "name": "*1",
          "haplotype": {
            "name": "*1",
            "id": "PA166115841",
            "alleles": [
              "C",
              "CAT",
              "G",
              "C"
            ],
            "cpicAlleles": [
              "C",
              "TA(7)",
              "G",
              "C"
            ],
            "reference": true,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "233759924:C;233760233:CAT;233760498:G;233760973:C;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": true,
      "variants": [
        {
          "position": 233759924,
          "rsid": "rs887829",
          "vcfCall": "C|C",
          "phased": true
        },
        {
          "position": 233760233,
          "rsid": "rs3064744",
          "vcfCall": "CAT|CAT",
          "phased": true
        },
        {
          "position": 233760498,
          "rsid": "rs4148323",
          "vcfCall": "G|G",
          "phased": true
        },
        {
          "position": 233760973,
          "rsid": "rs35350960",
          "vcfCall": "C|C",
          "phased": true
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": true,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    },
    {
      "source": "PHARMGKB",
      "version": "2024-08-27-21-12",
      "chromosome": "chr16",
      "gene": "VKORC1",
      "diplotypes": [
        {
          "name": "rs9923231 variant (T)/rs9923231 variant (T)",
          "haplotype1": {
            "name": "rs9923231 variant (T)",
            "haplotype": {
              "name": "rs9923231 variant (T)",
              "id": "PA166300423",
              "alleles": [
                "T"
              ],
              "cpicAlleles": [
                "T"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "31096368:T;"
            ]
          },
          "haplotype2": {
            "name": "rs9923231 variant (T)",
            "haplotype": {
              "name": "rs9923231 variant (T)",
              "id": "PA166300423",
              "alleles": [
                "T"
              ],
              "cpicAlleles": [
                "T"
              ],
              "reference": false,
              "structuralVariant": false,
              "numCombinations": 0,
              "numPartials": 0
            },
            "sequences": [
              "31096368:T;"
            ]
          },
          "score": 2
        }
      ],
      "haplotypes": [
        {
          "name": "rs9923231 variant (T)",
          "haplotype": {
            "name": "rs9923231 variant (T)",
            "id": "PA166300423",
            "alleles": [
              "T"
            ],
            "cpicAlleles": [
              "T"
            ],
            "reference": false,
            "structuralVariant": false,
            "numCombinations": 0,
            "numPartials": 0
          },
          "sequences": [
            "31096368:T;"
          ]
        }
      ],
      "haplotypeMatches": [],
      "phased": false,
      "variants": [
        {
          "position": 31096368,
          "rsid": "rs9923231",
          "vcfCall": "T/T",
          "phased": false
        }
      ],
      "variantsOfInterest": [],
      "matchData": {
        "missingPositions": [],
        "positionsWithUndocumentedVariations": [],
        "treatUndocumentedVariationsAsReference": false,
        "phased": false,
        "homozygous": true,
        "effectivelyPhased": true
      },
      "uncallableHaplotypes": [],
      "warnings": null
    }
  ],
  "vcfWarnings": {
    "chr19:38499696": [
      "The genetic variation at this position does not match what is in the allele definition (expected G, found T in VCF).  Undocumented variations will be replaced with reference."
    ]
  }
}